(WILL GIVE BRAIN)There is a low-pressure system moving in from the South, and a cold front moving in from the North. Both systems are expected to reach your area on the same day. Prepare a short news report to brief viewers on what the forecast looks like in the coming days.

(WILL GIVE BRAIN)There Is A Low-pressure System Moving In From The South, And A Cold Front Moving In

Answers

Answer 1

Answer:

Cold fronts move faster than warm fronts because cold air is denser, meaning there are more molecules of material in cold air than in warm air. ... Because air is lifted instead of being pressed down, the movement of a cold front through a warm front is usually called a low-pressure system.

Explanation:


Related Questions

what is the structure identified by the arrow in the diagram below?

A. Chromosome
B. DNA Strand
C. Gene
D. Cell

Answers

Answer:

A.}Chromosome

Explanation:

According to the research, a chromosome is the structure identified by the arrow in the diagram below.

What is a chromosome?

It is a condensed structure of DNA (deoxyribonucleic acid) present in cells that contains genetic information.

In this way, they have a double structure, composed of two structures parallel to each other and joined by a centromere, called chromatids, in each of the "arms" of a chromatid the genes are located.

Therefore, we can conclude that according to the research, a chromosome is the structure identified by the arrow in the diagram below.

Learn more about chromosomes here: https://brainly.com/question/12537598

#SPJ2

Explain why a food web is a more realistic model of energy flow than a food chain. 3 to 5 sentences.

Answers

Answer:

It includes more organisms in the ecosystem that would otherwise not be shown in a food chain.

Explanation: Food chains show just a single feeding pattern. Each organism has a single role in the ecosystem. Food chains make it easier to visualize trophic levels, or how energy moves through the ecosystem. This is why webs are considered to be more realistic than simple food chains.

Answer:

it includes more organisms in the ecosystem that would otherwise not be shown in a food chain. is right

Explanation:

PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU!

Answers

Answer:

U cant answer E if others are wrong or unknown

Explanation:

Which of the following statements about animal behavior is false?
A. Two animals of the same species will behave differently.
B. Instinctive behaviors begin at birth.
C. Learned behaviors are demonstrated to young animals by adult animals.
D. Animals behave in ways that enhance their chances of survival.

Answers

Answer:

i feel like is D not sure tho im sorry if im wrong

The following statements about animal behavior are false: Two animals of the same species will behave differently, as shown in Option A, as there are many similarities in behavior between members of the same species.

What is animal behavior?

Animal behavior is a complex and fascinating topic that can shed light on a variety of biological questions, including how animals interact with their environment, how they communicate with each other, and how they adapt to changing conditions. One important aspect of animal behavior is the distinction between instinctive and learned behaviors. Instinctive behaviors are innate, meaning that they are genetically programmed into an animal and do not require any prior learning or experience.

Hence, the following statements about animal behavior are false: Two animals of the same species will behave differently, as shown in Option A.

Learn more about animal behavior here.

https://brainly.com/question/441367

#SPJ3

Severe weather can occur anywhere, but not every area experiences the same severe weather. Hurricanes are a type of severe weather that only occurs in certain places. In the space below, explain why hurricanes form in tropical latitudes and not in other places.

Answers

Explanation:

The reason that hurricanes form around the tropics and not at the equator is that there needs to be Coriolis effect. Coriolis effect is what cause the winds to deflect to the right in the Northern Hemisphere and the left in the Southern Hemisphere.

socratic dot org

The first person that wrote the answer is correct

1. The location of two hikers is marked on the topographic map to the right as points F and H. What is the elevation of the camper at point F?
2. Each hiker climbed to point G along the path indicated by the arrow. What was the change in elevation for the hiker that took the steepest path to point G?

3.The Vs just below the path of F up to G indicates what landform?

4. What is the purpose of this series of satellite images?
A. To show the path of three different rivers
B. The direction the water flows in the river
C. The changes in the path of the river

5. Weathering (breaking off sediments upriver), erosion (moving the sediments down river) and finally deposition caused the changes in the river.
What helps hold sediments in place to prevent erosion?

Answers

Answer:

1. 740 m

2. 50 m

3. Valleys

4. A

5. Mulchin

Explanation:

anyone could help it would be great

Answers

Answer:

water and soil

Explanation:

water and soil is your answer

Please helppppp ASAP mark you Brainliest
1. Answer choice: (natural selection, diversity, scientific theory of evolution, genetic variation) and (environmental factors, inherited, inherited, extinct)

2. Answer choice: (national selection, diversity, environmental factors, extinct)

3. Answer choice: (national selection, genetic variation, inherited, environmental factors) and (genetic variation, extinct, diversity, inherited)

Answers

Answer

I don’t know for sure but I think.

1:scientific theory of evolution and inherited

2:extinct

3: national selection and genetic variation

I hoped it helps

Hi. Can anyone help with this please. And also show proof of the correct answer

Answers

Don’t press on those links ⚠️
The answers are A and C.

A; it depends on the environment, making survival easy — such as living in a forest due to biodiversity compared to living in a desert, where you can easily die

C; Natural selection kills the organism with weaker traits, survival of the fittest. Those who survive have strong traits and if their able to reproduce, they pass those traits into their offspring and natural selection repeats

PLZZ

Which is NOT a characteristic of a vertebrate?

A-have blood

B-have exoskeleton

C-have a nervous system

D-have backbone

E-have protective skin covering

Answers

The answer is B to your question
Answer is B.............

please help with will give brainilist
1 What is the most likely meaning of concentration
A thinking about one thing in a focused way
B amount of a substance found in water
C area where something comes from
D chance to be found

2 How could point source pollution best be described?
A Soap suds from washing a car flow into a storm drain.
B Water moves across the watershed, picking up natural or human-made pollutants.
C Chemicals or other contaminants flow into the streams from an obvious and identifiable source.
D Bacteria enters the water from animal waste that is left behind when someone is walking a dog.

3 What could be an easy way to prevent non-point source pollution?
A Let someone else wash your car.
B Keep businesses and industries from disposing of hazardous chemicals.
C Farmers can make sure that waste treatment tanks do not spill or leak into the groundwater.
D Don't use too much fertilizer on your yard. When it rains, there won't be any excess to run off into a storm drain.

4 What percentage of Earth's water is NOT liquid, fresh water that is available for us to drink and use.
A 99%
B 97%
C 3%
D 1%

5 The lake near a small city has become polluted. One group blames the local factory for the pollution. The factory claims that non-point source pollution from the growing city population is to blame.
Which of these tests would NOT help local citizens figure out if the pollution was from a point source or non-point source?
A Compare samples from different places around the lake.
B Observe the areas where water leaves the factory.
C Laboratory analysis to find out what pollutants are in the water.
D Examine the wildlife of the lake to see how it is affected by the pollution.

6 A community is concerned that its river has become polluted. Analysis of water samples shows small amounts of over 20 different chemicals. Which of the following is the most likely cause for the increase in pollution?
A The increase is due to agricultural point source pollution.
B The increase is due to industrial point source pollution.
C The increase is due to residential non-point source pollution.
D It is impossible to determine.

Answers

1. B; due to the subject being biology, it isn’t about the mental aspect. Concentration in biology is the amount of a substance in a given area.

2. C; While you may believe it to be B, that isn’t correct answer. Going back to the question, it ask for the point source, which is a main source. Water isn’t a main source, as it carries objects. Chemicals ARE a main source as it was main created from a chemical plant making identifiable.

3. B; Point source pollution is mostly produced by industries and businesses, chemicals and such.

4. B; If I have read that correctly, that being how much isn’t fresh water, then I’m correct as fresh water takes up very little of the ocean compared to salt water

5. C; it’s quite useless knowing what’s in the water compared to where it’s being placed

B; Industrial point source pollution as it being chemicals, which are produced by industries

Answer:

1. B;  

2. C; .

3. B;  

4. B;  

5. C;

6.B;

In humans, having freckles is dominant over not having freckles. Jodie and Brian are both hybrid (Ff) for freckles. They have four children. What is the chance that each child has freckles? (Remember that with each birth, the chance of having a child with or without freckles starts over.

A.) 1 out of 4

B.) 2 out of 4

C.) 3 out of 4

Answers

the answer to the question is c

what do we mean when we sat technology helps “ redistribute" natural resources?

Answers

Technology is an important factor that an change substances into resources. ... It is their ideas, knowledge, inventions and discoveries that lead to the creation of more resources. Each discovery or invention leads to many others

In addition, technological advances are helping to bring down the cost of renewable energies

Explanation:

Resource distribution refers to the distribution of resources, including land, water, minerals, wealth in general among corresponding geographic entities (states, countries, etc.). Resource distribution refers to the geographic occurrence of resources on earth. In other words, where resources are located.

Meaning to hand out environmental things in nature.

Reproduction in yeast: is a slow process usually takes several days is very fast uses mitosis

Answers

Answer:

Reproduction in yeast is very fast uses mitosis.

Explanation:

Yeast has a phenomenal growth rate and can duplicate itself every 90 minutes (I searched this up)

Mitosis is where one cell splits in half and becomes two cells.

Hello yall! I was wondering if yall could help me with these problems!

Answers

C,d,e .................
C,d,e...........❤️❤️❤️❤️❤️❤️❤️❤️

What is one-way water moves through the nonliving parts of an ecosystem during the water cycle?
A. Sweating
B. Evaporation
C. Photosynthesis
D. Transpiration

Answers

C. Evaporation

hope this helps :)
Your answer would be B

please help me with this

Answers

Moon I’m pretty sure!

Answer:

The Sun

Explanation:

The sun has the greatest gravity because it exerts a lot of gravity, or pull, on the planets—enough to make them orbit around it. Also, the Sun's gravity is about 27.9 times that of Earth, and the gravity of the moon is less than Earth's.

1. The location of two hikers is marked on the topographic map to the right as points F and H. What is the elevation of the camper at point F?

2. Each hiker climbed to point G along the path indicated by the arrow. What was the change in elevation for the hiker that took the steepest path to point G?

3.The Vs just below the path of F up to G indicates what landform?

4. What is the purpose of this series of satellite images?
A. To show the path of three different rivers
B. The direction the water flows in the river
C. The changes in the path of the river

5. Weathering (breaking off sediments upriver), erosion (moving the sediments down river) and finally deposition caused the changes in the river.
What helps hold sediments in place to prevent erosion?

Answers

aacbb are your answers

The heart sends red blood cells to the _________ to pick up oxygen before sending the now oxygen-rich blood to the rest of the body.

A. Liver
B. Kidneys
C. Lungs
D. Legs and Arms

Answers

the answer is Lungs i’m pretty sure
Answer:
C.Lungs

Explanation:

Guys Label answer and say 2)... 3)...

Answers

Answer:

3. multicellular

Explanation:

not a bacteria, because, well, its an insect, its not a prokaryote, because an insect has more than one cell, and prokaryotes are unicellular, and its not abiotic because an insect is a living thing

sorry, not sure about no. 2

2) is a building block for figure B

3) multicellular

EXPLAIN THE ANSWER AND I WILL GIVE BRAINLIEST:

Answers

so it says i have to text 20 but um that well be C

Answer:

c. Explanation below.

Explanation:

A, B, and D are wrong. Because that does not happen in the stroma.

C is the only answer that makes sense. When the guard cells of the stroma are full of water, the weight of the water being blocked pushes through.

I hope this cleared things for you, please mark my answer brainliest. If you need more info watch some videos, they might help you understand better.

What two Units do Astronomers use to calculate Distance to Stars

Answers

Answer:

astronomical unit (AU) and light years

Explanation:

“Coronavirus Is Mutating”, what could be the reason for it? (Research) and tell your answer in your own simple words

Answers

Answer:

Explanation:

Coronavirus is mutating because as more people are getting the virus, that gives that virus a change to mutate and form a different strand. When a virus hijacks a person cells, it causes that cell to start producing the DNA of the virus, but because human cells where not made to produce the DNA of a virus, mistakes happen, thus slightly changing the DNA of the virus which can then cause a new strand of the virus to appear.  

HOW WAS OIL FORMED? in 4 step plss

Answers

About 300 million years ago, these dead organic materials such as zooplankton and algae built up on the bottom of lakes and oceans in conditions where they couldn't decompose. The organic matter then changed into kerogen, which eventually turned into oil through heat and pressure.

1. Describe what bacteria are - their parts, how they can be good, how they can be bad, and the different types.
Pls help will mark Brainlyest or whatever

Answers

Answer:

Many human illnesses are caused by infection with either bacteria or viruses. Most bacterial diseases can be treated but some can’t be. Some viruses give a challenge to the body’s immune system because they hid in the cells

Explanation:

Which of the following sets of equipment can be used to analyze the effects of human activity on a watershed?

A) Water testing kit, triple beam balance
B) Water testing kit, beaker, hotplate
C) Hotplate, beaker, graduated cylinder
D) Water testing kit, hand lens, notebook

Answers

Answer:

the answer is d

Explanation:

i’m not sure but i believe it is A

Someone please help for 10+ points and marked Brainly

Answers

Answer:

numder 2

Explanation:

because your body is trying to warm up by rapidly moving your muscles

Number two for your answer

help please, parathyroid glands produce hormones that are essential to the proper function of which system

Answers

Parathyroid glands are important for controlling calcium levels and keeping your bones strong so D

I NEED AN ANSWER QUICK PLEASE

If you cross an AABb individual with an Aabb individual, what will the genotype ratio be in the next generation? What will be the phenotype ratio?

Answers

Answer:

help me too pls i need help

Explanation:

I need to know what A and B stand for to help you with the phenotype.

Genotype Ratio: Aa 25% aB 25% Ab 25% Bb 25%

Describe the process of decomposition during hurricane sandy. no links

Answers

The decomposition is a process that occurs when the organisms are dying. The process stars shorty after the death of the organism. The decomposition occurs  by abiotic and biotic processes, with the abiotic happening through hydrolyses, while the biotic happening because of the microorganisms. This process is part of the nutrient cycle, and it is crucial for the recycling of the finite matter. The decomposition is also what has enabled the formation of the soils, as the soils are a mixture of sediments and decomposed biomass.
Other Questions
Can someone pleaseeee help and if youre correct ill give brainliest Can someone please help me!?WILL MARK BRAINLIEST :) I NEED HELP ASAP!!!!!!! will give brainliest How does the content of the passage reflect the author's point of view?A. It shows that the author feels hopeless about the fate of our planet.B. It provides facts and statistics showing that the problem of water shortages is growing.C. It shows that the author dislikes the fact that cities are growing faster in the southwest than elsewhere.D. It shows that the author approves of ongoing scientific research. How was Benjamin Franklin similar to Enlightenment thinkers? The path of a rope bridge can be modeled by a quadratic equation h(l), where h is the height at a point on the bridge relative to the two ends of the bridge and l is the distance from one end of the bridge. One such bridge connects two ends that are 24 meters apart. The lowest point of the bridge is 3 meters lower than the two ends of the bridge Assuming the two ends of the bridge are at an equal height of h = 0 meters, which of the following graphs could be the graph of h (l)? why do some scientists believe that humans evolved from apes?a: because fossil records show homologous structures indicating a common ancestor b: because humans and apes lived around the same time period After sitting out of a refrigerator for a while, a turkey at room temperature (69F) isplaced into an oven. The oven temperature is 300F. Newton's Law of Heatingexplains that the temperature of the turkey will increase proportionally to thedifference between the temperature of the turkey and the temperature of the oven, asgiven by the formula below:T = Ta + (T. T.)e-ktTg = the temperature surrounding the objectTo = the initial temperature of the objectt= the time in hoursT = the temperature of the object after t hoursk = decay constantThe turkey reaches the temperature of 127F after 3 hours. Using this information,find the value of k, to the nearest thousandth. Use the resulting equation todetermine the Fahrenheit temperature of the turkey, to the nearest degree, after 5hours.Enter only the final temperature into the input box. Based on what you read about the Compromise of 1850, what would you say was the worst part about it for the future of the United States and why? in 3/4 of an hour Ryan codes 3/5 of his game. at this rate how much of the game can he code in 1 hour The ratio that compares the measurements of a model and the real object is called what? help ASAP For brainlessly what is the complementary DNA of TACCGGATGCCAGATCAAATC? Which transition would best fit in the blank?We need to wash the dishes. ( ), we can go to the county fair.O A. AlthoughO B. After thatC. MeanwhileD. Similarly Relationship break up because of a number of reasons.Name and explain Two factors that contribute to a detrimental relationship? Solve for x given the picture I need an explanationWill mark brainliest Select the correct responses: Cules son los 3 usos de se mencionados en el video?Question 10 options:Los pronombres de doble objetoVerbos como gustarEl "se" impersonalLos pronombres demonstrativosEl "se" transitivoVerbos reflexivos y recprocos Please help me with 1,2,3,4,5,6,7,8,9,10,11 please I really need help explain how the genus and species name of an organism is properly written Explain what benefits you can achieve while performing either exercise? I needddd helppppp !!!whats the answer ?