Answer:
ATGGCCTACGGTCTAGTTTAG
Explanation:
A=T
C=G
G=C
T=A
This is the key to finding a complementary DNA strand.
2. Describe the info flow of transcription. (A. DNA --> DNA / B. DNA -> RNA / C. RNA --> protein / D.
DNA --> protein)
3. Describe the info flow of translation. (A. DNA -> DNA / B. DNA -> RNA / C. RNA --> protein / D. DNA-
-> protein)
4. Describe the info flow of expression. (A. DNA --> DNA/B. DNA --> RNA / C. RNA --> protein / D. DNA
--> protein)
5. Describe the info flow of replication. (A. DNA --> DNA/B. DNA --> RNA / C. RNA --> protein / D. DNA-
-> protein)
Answer:
I think the dna is like in the butt but I really have no key to my hose
Explanation:
jsnfjfnf
In which ways might ocean currents be like streams and rivers on land
Answer:
Ocean currents act much like a conveyor belt, transporting warm water and precipitation from the equator toward the poles and cold water from the poles back to the tropics. Thus, ocean currents regulate global climate, helping to counteract the uneven distribution of solar radiation reaching Earth's surface.
Ocean currents in different ways might be like streams and rivers on land they sweep along the predictable paths. Ocean currents flow at the surface, and flow deep within the waterbodies.
What are Ocean currents?Ocean currents act much like similar to a conveyer belt. Ocean currents transport warm water and precipitation of water from the equator towards the poles and cold water from the poles back to the tropics of the globe. Thus, the currents which regulate global climate, helping to counteract the uneven distribution of solar radiations reaching to the Earth's surface.
Ocean currents flow like that of vast rivers, sweeping along with the predictable paths. Some of the ocean currents flow at the surface and others flow deep within the water. Some ocean currents flow for very short distances, however others cross entire ocean basins and even circle the globe.
Learn more about Ocean currents here:
https://brainly.com/question/21654036
#SPJ2
THIS IS EARTH SCIENCE
PLEADE ASNWER THE Two QUESTIONS IN THE PICTURE
How do ocean currents affect the coastal regions of S.America at 20 degrees south latitude
When a lake freezes over. How does the energy content of the lake change?
Answer:
Explanation:The remaining air (air that does not descend at 30 degrees North or South latitude) continues toward the poles and is known as the westerly winds, or westerlies
Infants are born with a number of instinctive reflexes.
True
False
Answer:
True
Explanation:
:D
can someone plzz help me on this its hard:( ill give brainliest
Answer:
B
Explanation:
using the graph, the temperature seasonal force from the other Forest biomes. choose all the apply
A) the temperature seasonal Forest averages 100 to 200 cm rainfall/year
B) the temperature seasonal Forest is cooler and wetter than the tropical rainforest
C) the temperature seasonal Forest has warmer average temperatures than the Boreal forest
D) the temperature seasonal rainforest has similar temperatures but less rain than the temperate rainfores
E) the temperature seasonal rainforest has similar rainfall to the Boreal and tropical seasonal rainforest, but is much warmer than either one
Answer:
The correct answer is - A and C,
Explanation:
According to the graph, the following conditions are matched correctly with the temperature seasonal forest with other biomes:
The temperature seasonal forest has the precipitation range from 50 cm to 250 cm rainfall per year approximately. The average rainfall from this would be 150 cm/year or between 100 to 200 cm per year.
B. the temperature seasonal forest has a temperature between 15 degrees Celsius to 20 degrees celsius which is warmer than the boreal forest that has a temperature between 0 to 15 degrees Celsius approximately.
Answer:
A, C, D
Explanation:
Earth science question. Please help
Answer:
answer choice 4, more rain and a steeper slope cause it to flow faster
Explanation:
What is science, what is your own definition of science to you.
Answer:
The way that the Universe works, the way that different things in life contribute to one another.
Explanation:
Dang, that got deep real quick
science can be defined as all about the nature.
PLEASE ANSWER
Essential Question: What causes the differences in average temperature and the changes
in day length that we associate with change in seasons on Earth?
Answer:
The evidence is valid because it represents how Earth's axial tilt impacts the temperature levels during each season. Conventionally, the Earth has an axial tilt of about 23.4 degrees, and revolves around the sun, ultimately causing seasons.
Explanation:
pls follow me and mark me as brainliest
3. Which type of heat transfer causes your face
to feel warm when you sit in the Sun?
SC.7.P.11.4
A conduction
6 convection
© insulation
O radiation
I don’t have a lot of time please help!
No websites or links.
Don’t answer it if you don’t now. Thanks
All living things contain biomass. Which element is the most important when creating
biomass?
a.Carbon
b.Nitrogen
c.Oxygen
Answer:
Carbon is the most important.
Explanation:
It's the main component
What are some actions you can take to reduce your carbon footprint?
Answer: learn the 5 R's: refuse, reduce, reuse, rot, recycle: Going zero waste is a great step towards combating climate change. ...
bike more and drive less: ...
conserve water and protect our waterways: ...
eat seasonally, locally, and more plants: ...
switch to sustainable, clean energy: Individuals and corporations can reduce their respective carbon footprints by installing energy-efficient lighting, adding insulation in buildings, or using renewable energy sources to generate the electricity they require. For example, electricity generation from wind power produces no direct carbon emissions.
Explanation:
The amount of nutrients present in a trophic level is called living state
The amount of carbon is present in the earth which is used to transfer from one component to another is called carbon footprint.
On earth, the emission of carbon is a major issue and we have to resolve it as soon as possible.
These are the following ways to reduce the carbon footprint:-
Stop deforestationReduce hunting.Planting more trees.Minimize the use of automobiles.Hence, the answer is mentioned is above.
For more information, refer to the link:-
https://brainly.com/question/12985618
Why do you think they split the reptiles into four different groups?
What is Florida’s most popular gamefish
Answer:
Sailfish
Explanation:
One of Florida's most popular gamefish is the Sailfish.
How does sexual reproduction reduces the risk of genetic disease?
Name 2 chordates that are not vertebrates.
Answer:
The other two subphyla are invertebrate chordates that lack a backbone. Members of the subphylum Urochordata are tunicates (also called sea squirts). Members of the subphylum Cephalochordata are lancelets. Both tunicates and lancelets are small and primitive.
Explanation:
Not really an explanation for this one.
A galaxy has less mass than a moon and more mass than a planet.
True
False
Answer:
False, major false. A galaxy is a small portion of the entire universe... it contains plants, stars, asteroids, moons are insignificant compared to it. Also, pretty much all moons are larger than planets so that wouldn't even make sense.
Answer:
FALSEExplanation:
First off a galaxy is one of the largest things in space, besides things like galaxy clusters.
Second all planets have more mass than the moon. Since planets have more mass than a moon, it is impossible to have less mass than a moon but more than a planet.
Finally, a galaxy is made up of millions of planets and moons. So it does not make any sense nor is it even possible.
A K-selected species will exhibit which of
the following characteristics?
A. wildly fluctuating population size
B. generalized niche
C. early reproductive age
D. low population growth rate
Answer:
it's D
Explanation:
This is because K-selected species produce fewer offspring in their life time compared to R-selected species therefore their growth rate is lower.
The option or characteristic that will be exhibited by K-selected species is that it has a low population growth rate. Thus, the correct option for this question is D.
What is a K-selected species?A K-selected species may be defined as a more or less stable population adapted to exist at or near the carrying capacity. These types of species have specialized niches along with a logistic growth model.
The reproductive rate of these species is low as compared to r-selected species. Reproductive age is late. They have a fairly strong competitive ability due to which they show very less fluctuation in population size. Examples of these species may include canopy trees, large mammals, large turtles, some parrots, etc.
Therefore, the option or characteristic that will be exhibited by K-selected species is that it has a low population growth rate. Thus, the correct option for this question is D.
To learn more about K-selected species, refer to the link:
https://brainly.com/question/29469563
#SPJ2
Reactionate
Reaction me
0
3
5
12
CH
Image Courtesy of 3DScience.com
The graph above shows the progress of an enzyme-catalyzed chemical reaction. Based on the graph this enzyme
is minimally active between pH 5-7
O works optimally between pH 5-7
O is minimally between pH 0-3
O works optimally between pH 0-3
Answer:
is minimally active between pH 5-7
i took the test
Observing Animals (Image Attached)
Let’s study and compare three animals: a frog, an ancient and extinct mammal-like animal, and an owl. Observe the illustrations, and then answer the questions.
1. How are the bodies of the three animals similar to one another? How are they different?
2. What might these similarities suggest about the common ancestor of these organisms?
Answer: They each have patches on their stomachs. Also, all 3 animals have claws or legs, even though they play different function in each organism, they 3 still share the same characteristics of having claws or legs.
Explanation:
I am also trying to understand the 2nd question, but this is the answer to the 1st one.
If humans began hunting seals MORE, what would happen to the population of Penguins and Krill?
Answer:
the population of penguins and krill will go up
In the illustration below, Picture 4 represents...
Opoints
Picture 1
Plcture 2
Picture 3
Picture 4
Answer:
i think it's A i'm not 100% sure let me know if it's right
Explanation:
An eastern screech owl, a carnivore, might compete with which organism most intensely for resources?
A. hawk (secondary consumer)
B. mountain lion (secondary consumer)
C. wren (primary consumer)
D. mouse (primary consumer)
NO LINKS PLEASE
Examples of how humans negatively affect local ecosystems are
A. Building dams, deforestation cutting down trees), adding point sources to nearby streams to allow for run-off, building roads and structures, and salting roads
B. Planting trees and other plants to attract native species
C. Creating laws to prohibit fishing from local streams
D. Removing non-native species from the environment.
Answer:
A. Building dams, deforestation cutting down trees), adding point sources to nearby streams to allow for run-off, building roads and structures, and salting roads.
Explanation:
Removing non-native species from the environment helps the native ants to thrive without having any changes in the ecosystem effect them (i.e. new invasive animal).
Creating laws to prohibit fishing from local streams helps keep the fish alive and allowing them to continue to use this stream.
Planting trees and other plants to attract native species helps secure and grow the ecosystem of that area.
This leaves A as the answer.
Hope that helps you!
When a pelican gets hot, it opens its bill and flutters the sides of its pouch. This causes water to evaporate, which cools the pelican. What type of adaptation is the movement of the pelican’s pouch?
behavioral adaptation
life-cycle adaptation
physical adaptation
reproductive adaptation
Answer:
Behavioral adaptation
Explanation:
life-cycle adaptation would be like a tadpole growing legs.
physical adaptation would be a change in the animals body like wings for a bat.
reproductive would be beneficial for making offspring like a peacocks bright feathers that attract mates.
Behavioral adaptations are responses to external stimulus like heat.
So behavioral is the best option.
Which of the following signal words can be used to
give examples of an idea?
A. Then
O B. Eventually
O C. Because
D. Specifically
Answer:
A
Explanation:
If your word is "than" it is a signal word that is used to give an idea because it allows the writer to compare and contrast ideas or phrases.
Answer:
C. Because
Explanation:
During fertilization, sperm cells will either contain an x or a y chromosome in addition to 22 other chromosomes, totaling______
which type of gene mutation occurs when a base is added?
A duplication consists of a piece of DNA that is abnormally copied one or more times. This type of mutation may alter the function of the resulting protein. Frameshift mutation: This type of mutation occurs when the addition or loss of DNA bases changes a gene's reading frame.
The role of a pioneer species in primary succession is to change a bare habitat into Abe that is suitable for other organisms. A species that is responsible for primary succession in an ecosystem is most likely able to-
A.)live at high altitudes
B.)migrate during the winter
C.)survive any predator
D.)carry out photosynthesis
