SAQ-3: In Literature, reading and writing is one of your subjects in
Grade 11, how does it help you in other subject like Practical Research?​

Answers

Answer 1

Answer:

It helps u in life

Explanation:


Related Questions

Hi, Im Rick Mingrove. On TV I play a famous doctor. Thats why im asking you to try freshie mouthwash. Freshie kills odor-causing germs and leaves your breath smelling as fresh as a mountain stream. So try freshie, your favorite doctors choice

Answers

Okayyyyyyyy dokayyyyyy I will. :)

This sentence has some mistakes in capitalization, punctuation, and use of adjectives. Select each word or group of words that has a mistake.

the excited students entered the cave dark and looked Around. Smart two students saw some crayfish.

Answers

Answer:"the" should be capitalized

Explanation:

Answer:

around shouldnt be in caps

answers:the around cave dark

Context clues provide:
A. information in the text that helps you find the meaning of a word.
B. a strategy for remembering new vocabulary words.
C. the meaning of a passage's main idea.
D. a way to stay engaged with a text.
i think it’s C !!

Answers

I think the answer is C

Answer:

The answer is actually A. information in the text that helps you find the meaning of a word.

Explanation:

I took the quiz, but if you want further explanation, look at the image below from my study guide.

2. What does the phrase "dry out" mean as used in paragraph 6?
O A to stop showering or bathing
B to stop having dangerous thoughts
C to stop being dependent on alcohol
OD to stop getting in trouble with the police

Answers

Answer:

B

Explanation:

Having dangerous thoughts

B to stop having dangerous thoughts

Which of these are characteristics of a video news report?

visual modality
auditory modality
written text
facts or information
hands-on interaction
real-time reporting

Answers

Answer:

A,B,D,F

Explanation:

correct on edg

A video news release (VNR) is a video piece that appears to be a news story but was produced by a public relations firm, advertising firm, marketing company, corporate, or government organization.

The characteristics are Options A, B, D, and F.

What are VNR's detractors?

VNR critics have labeled the method dishonest or a propaganda tactic, especially when the segment is not identified as a VNR to the audience.

VNR producers disagree, comparing their use to that of a video press release and pointing out that editorial judgment on the worthiness of a VNR's content, in part or whole, remains in the hands of journalists, program producers, and others.

The Federal Communications Commission in the United States is now investigating VNRs.

For more information about VNR refer to the link:

https://brainly.com/question/20613539

#SPJ2

Today, alternative energy is the buzzword of the nation. Millions of dollars of research money are going into so-called "green" technologies that are supposed to be more environmentally friendly. Although it is nice to think that we can save the planet by driving "green" cars, that simply isn't true. We cannot get something for nothing.

Select two words from the paragraph that intended to get the reader thinking of green technologies in a negative light. Type in the letter choices of TWO words in the box below:
A. alternative
B. buzzword
C. research
D. so-called
E. environmentally
F. planet

Answers

The right answer is f and e

WHO IS EXCITED FOR STONE OCEAN!?

Answers

Answer:

MEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

Explanation:

Answer:

ME

Explanation:

Claim: Having a school library is a great benefit to students because it will help them to learn. What kind of evidence would support this claim? Check all that apply. a quotation from a student who has books at home an example of a student who is not able to get to a public library a detail that includes teacher support for a school library a reference to an article about public library funding

Answers

Answer:

I mean I know that one of the answers are B i hope this helps :D

Explanation: i have edge

Answer:

its b and c

Explanation:

i just did it :)

Which sentence correctly uses a colon to introduce a quote?
Select one:

Veterinarian Cindy Frost, a dog-lover: People with dogs “are simply happier.”

Veterinarian Cindy Frost is a dog-lover, who reminds us that: people with dogs are simply happier.

Veterinarian Cindy Frost discusses being a dog-lover: “People with dogs are simply happier.”

Veterinarian Cindy Frost discusses: being a dog-lover, “People with dogs are simply happier.”

Answers

Answer:

the third sentence uses colon to separate the quote.

Please someone help me

Answers

Answer:

f-h: Mainly students deal with the problem of spending too much time on distractions. When this happens, it can make accomplishing tasks more difficult.

i-k: Furthermore, students need to learn that time is limited, and need to plan their time wisely.

l-m: Ultimately, poor time management prevents students from being successful in their school and lives.

n-o: In order to overcome these barriers easily, follow these simple recommendations

Explanation:

What is one feature you believe all poems should have

Answers

Answer: meter, rhyme, form, sound, and rhythm (timing). Different poets use these elements in many different ways.

Explanation:

Answer:

A good poem is a symptom of the author's effort to make sense of the world. And often, ideas that can't be expressed in prose can sometimes be expressed through strong images. A good poem often uses clear, memorable, concrete images to make a point.

Explanation:

hope this helps

PLS!!!!!!! Make a thesis Statement about why there should be gun restrictions!!!!!

Answers

Answer:

It is very important to raise the issue of gun control because there have been an enormous amount of violent acts and massacres caused by guns. Thirty-thousand people should not be killed every year due to the open use of guns. ... Gun deaths could be easily preventable with a few stricter regulations.

The main conflict of Their Eyes Were Watching God occurs in:
A.Eatonville, Florida
B.Janie's mind
C.Pheoby's imagination
D.the Everglades

Answers

Answer:

The answer is D the everglades

Explanation:

I read the bible                                                                                            

Answer:

The answer is the Everglades

Explanation:

Because Alicia forgot her racket at home, she wasn't able to practice with the rest of the tennis team.


How is the underlined linking word used in this sentence?

choices- a. signal additional information
B. to indicate time or sequence
C. to illustrate a comparison
D. to show cause and effect

Answers

Answer:

the answer is D

Explanation:

Which sentence is conditional?
O If you are hungry, eat a piece of fruit.
O Don't eat candy because it isn't good for you. O Please don't eat so many potato chips.
O It isn't healthy to eat so much cake.​

Answers

Answer:A

100% correct

 What does the root form mean in the word formulate?

Answers

It means to Create or make

Why should journalists avoid using too many big words?
O A.
Readers cannot understand big words.
OB. They can make an article seem heavy.
O C. They run the risk of misusing the big words.
OD.
Readers have a hard time finding the facts.

Answers

Answer:

Journalists avoid using too many big words because readers cannot understand big words. Therefore, the answer. A. Readers cannot understand big words.

Answer:

C. They run the risk of missusing these words.

Explanation:

How many times have you used a big word you thought you knew the definition to only to find out you have to use it a cirtain way, welp that's why it would be C. Pluuuss, It was in my instructions. And taking times text so gotta go!

Hope this helped!

Student E made the claim, “The legal driving age in the U.S. should be 18 years old.” Which of the following is an example of an appropriate counterclaim the student might make?

Select one:

Many people feel that there should be an upper age limit for driving: elders over the age of 80 tend to lose the mental capacity to safely drive a vehicle.


It might appear as if cars are well-made and are thus safe to drive.


It is often supposed that smoking inhibits a teenager’s mental senses.


Many people argue that teenagers are developmental capable of driving by 16, or even younger.

Answers

Answer:

4. fourth one

Explanation:

Answer:

n

Explanation:

A decomposer is an organism that:
A. cannot be seen without a microscope
B. causes disease
C. reproduces using spores
D. reeds on dead plants and animals

Answers

Answer:

it is B i think

Explanation:

Answer:

The answer is D

Explanation: Decomposers are organisms that break down dead or decaying organisms.

Are you the person in charge here ____

Answers

Answer:

for gaurd

Explanation:

incharge means that it is in an work so work might be gaurd or manager

hope it helps you

please mark me as brainlist

I think so hope that helps I hope you have a wonderful day

What is the meaning of the following quote?

“The best way to cheer yourself, is to cheer someone else up.”  --Mark Twain (American author of Tom
Sawyer)

Answers

Answer:

When you make others happy it will make you feel good and this will make you happy.

Explanation:

Answer:

By cheering someone else up, you are making youreself happier because there is a happy feeling inside you that you helped somebody. Hope it helps.

Explanation:

What is the tone in the
underlined passage of "The
Californian's Tale" by Mark
Twain?
A. The narrator uses a light, informative
tone.

B. The narrator uses a serious, thoughtful
tone.

C. The narrator uses a humorous tone.

Answers

Answer:

the answer is A

Explanation:

because this is information, he is telling you what he was doing 35 years ago.

I believe the answer is a

Which statement best evaluates the effect of adding descriptive detail in the
second version of the passage?
Passage 1:
"Ready or not, here I come! I walked around, checked behind the
curtains, and then picked up each couch cushion. I tried not to laugh
when I heard a noise from behind the couch. Then I walked behind the
couch. "There you are!" Jaxon ran straight to my arms.
Passage 2:
"Ready or not, here I come." Walking slowly around the living room,
glanced behind the curtains and then playfully peeked under each
couch cushion. "Wow, Jaxon is such a good hider! I'll never find him,"
said aloud, trying to keep my laughter to myself. A giggle escaped
from behind the couch. 'I wonder if he could be hiding behind here.
With that, I jumped around the couch and exclaimed, "There you are!"
Thrilled to be found, Jaxon jumped up and ran straight to my arms.

Answers

Answer:

D: it makes the passage more interesting by enabling the reader to visualize the scene.

Answer:

D

Explanation:

why can a sqare never be a trpazoed

Answers

Answer:

Because all squares must have parallel sides

Explanation:

Hope this helps :P

Answer: A square requires all four sides of equal length, having two pairs of parallel sides, and all 4 angles right-angles. A trapezoid has two sides that are parallel, while the other two sides must be not parallel.

Q2:How does communication take place, elaborate in detail?

Answers

Answer:

The communication process refers to a series of actions or steps taken in order to successfully communicate. It involves several components such as the sender of the communication, the actual message being sent, the encoding of the message, the receiver and the decoding of the message.

it takes place in messenger,  etc....

plz thanks

What is the name given to the opening between the vocal cords?

Answers

Answer:

Guts, known as oesophagus

Answer:

The glottis is the opening between the vocal folds (the rima glottidis).

Explanation:

The space between the vocal folds is known as the rima glottidis. Fig 3 – The vocal ligament forms from the free upper edge of the cricothyroid ligament.

What is the suffix in the word Segregation?

se
seg
on
ation

Answers

Answer:

ation is the correct answer

Explanation:

This is a suffix because it indicates that this word is a noun. segregation means the act of keeping two things apart. I hope this helps! Have a GREAT day!

explain whether or not there are absolute answers to moral questions (such as "what does it mean to be a good person"). In other words, if I think it is always wrong to lie, and you think lying is alright to spare another's feelings, are you wrong or am I wrong or are we both right for ourselves? In goodness relative or absolute?

Answers

Answer:

To be a good person means a lot to you and others around you. A good person can be reliable, trusted, honest and truthful.

In that case the first person is right, because is you lie to spare others feelings you may still hurt or disturb others feelings. In other words, others may not trust in you anymore and can term you as a bad person, and this may disturb your own feeling.

Read the paragraph. Then answer the question that follows.

Perhaps you wanted pizza for dinner, but were out voted by the rest of the family who wanted chili. This is similar to what happens in a community. One person has to give up a right for the good of the group. Sometimes citizens' duties and rights conflict with each other. A good example is a public protest. People have the right to meet in groups and share ideas. However, a protest can disrupt traffic or other normal activities. A city must provide extra police protection to keep people safe. Therefore, the city has the right to require permission in advance for a protest. Government must make laws to balance the rights of individuals and different groups of people.

What type of connection is used in the paragraph? (5 points)

A. Simile
B. Contrast
C. Category
D. Analogy

Answers

Answer:

its not A. i think that the answer might be b

Why don't Ulrich and Georg kill one another?
A
They are too civilized and can't bring themselves to kill the other.
B
They decide they need to help one another escape the storm.
They are interrupted and trapped under a falling tree.
D
Neither one is willing to shoot the other first.

Answers

Answer:

A tree falls on them before they get violent. They both understand each other better now that they are both trying to survive.

Explanation:

Answer: C

Explanation: They are interrupted and trapped under a falling tree.

Other Questions
Can someone pleaseeee help and if youre correct ill give brainliest Can someone please help me!?WILL MARK BRAINLIEST :) I NEED HELP ASAP!!!!!!! will give brainliest How does the content of the passage reflect the author's point of view?A. It shows that the author feels hopeless about the fate of our planet.B. It provides facts and statistics showing that the problem of water shortages is growing.C. It shows that the author dislikes the fact that cities are growing faster in the southwest than elsewhere.D. It shows that the author approves of ongoing scientific research. How was Benjamin Franklin similar to Enlightenment thinkers? The path of a rope bridge can be modeled by a quadratic equation h(l), where h is the height at a point on the bridge relative to the two ends of the bridge and l is the distance from one end of the bridge. One such bridge connects two ends that are 24 meters apart. The lowest point of the bridge is 3 meters lower than the two ends of the bridge Assuming the two ends of the bridge are at an equal height of h = 0 meters, which of the following graphs could be the graph of h (l)? why do some scientists believe that humans evolved from apes?a: because fossil records show homologous structures indicating a common ancestor b: because humans and apes lived around the same time period After sitting out of a refrigerator for a while, a turkey at room temperature (69F) isplaced into an oven. The oven temperature is 300F. Newton's Law of Heatingexplains that the temperature of the turkey will increase proportionally to thedifference between the temperature of the turkey and the temperature of the oven, asgiven by the formula below:T = Ta + (T. T.)e-ktTg = the temperature surrounding the objectTo = the initial temperature of the objectt= the time in hoursT = the temperature of the object after t hoursk = decay constantThe turkey reaches the temperature of 127F after 3 hours. Using this information,find the value of k, to the nearest thousandth. Use the resulting equation todetermine the Fahrenheit temperature of the turkey, to the nearest degree, after 5hours.Enter only the final temperature into the input box. Based on what you read about the Compromise of 1850, what would you say was the worst part about it for the future of the United States and why? in 3/4 of an hour Ryan codes 3/5 of his game. at this rate how much of the game can he code in 1 hour The ratio that compares the measurements of a model and the real object is called what? help ASAP For brainlessly what is the complementary DNA of TACCGGATGCCAGATCAAATC? Which transition would best fit in the blank?We need to wash the dishes. ( ), we can go to the county fair.O A. AlthoughO B. After thatC. MeanwhileD. Similarly Relationship break up because of a number of reasons.Name and explain Two factors that contribute to a detrimental relationship? Solve for x given the picture I need an explanationWill mark brainliest Select the correct responses: Cules son los 3 usos de se mencionados en el video?Question 10 options:Los pronombres de doble objetoVerbos como gustarEl "se" impersonalLos pronombres demonstrativosEl "se" transitivoVerbos reflexivos y recprocos Please help me with 1,2,3,4,5,6,7,8,9,10,11 please I really need help explain how the genus and species name of an organism is properly written Explain what benefits you can achieve while performing either exercise? I needddd helppppp !!!whats the answer ?