Chapter 1 Question: Why didn't the plants and animals in the biodome have
enough energy storage molecules?

Answers

Answer 1
Because there was not enough carbon in abiotic matter.

Related Questions

How is a warm front different from a cold front?

Warm fronts cause snow flurries in the winter, while cold fronts cause several days of rainy weather.
Warm fronts cause rapid changes in weather, while cold fronts cause several days of cloudy weather.
Warm fronts cause several days of cloudy weather, while cold fronts cause heavy snow in the winter.
Warm fronts cause thunderstorms in the summer, while cold fronts cause rain when the air is humid.

Answers

Answer:

Warm fronts cause rapid changes in weather, while cold fronts cause several days of cloudy weather.

Explanation:

i'm pretty sure

Warm fronts cause rapid changes in weather, while cold fronts cause several days of cloudy weather. So, the correct option is B.

What are Warm and cold fronts?

A warm front forms when a mass of warm air enters a space that previously held cold air. As warm air passes over cooler air, it rises and cools, which can result in the formation of clouds and precipitation. Unlike a cold front, a warm front often brings with it lighter and more widespread precipitation. Warm fronts often bring warm temperatures and high humidity levels.

When a mass of cold air approaches an area that was previously surrounded by warm air, a cold front is formed. When cold air flows into warm air, the warm air is forced to rise rapidly, which can result in thunderstorms and heavy rainfall. More extreme weather changes, such as a sharp drop in temperature and drop in humidity, are often brought about by cold fronts.

So, the correct option is B.

Learn more about Warm and cold fronts, here:

https://brainly.com/question/21551311

#SPJ5

what process adds oxygen to ocean water?

Answers

Answer: photosynthesis

Explanation: this person explained: https://brainly.com/question/1147634

Oxygen can get into the water in several ways: Oxygen from the atmosphere dissolves and mixes into the water's surface. Algae and underwater grasses release oxygen during photosynthesis. Water flows into the Bay from streams, rivers and the ocean.

In what way does walking help The environment? How does it make you feel about the state of our environment?

Answers

Answer: Walking plays an important role in improving our quality of life because it helps protect and improve the living environment and natural resources. ... Communities designed to be walkable have the potential to reduce air pollution and greenhouse gases because people may choose to walk or bike rather than drive. Walking plays an important role in improving our quality of life because it helps protect and improve the living environment and natural resources. Improving the environment in turn brings added health benefits that come, for example, from cleaner air, less traffic noise and fewer road accidents.

Explanation:

Why do scientists carry out experiments?
A.
Because scientific knowledge is based on observations

B.
Because scientific knowledge is full of untested theories

C.
Because scientists like to control variables

D.
Because scientists like to work in labs

Answers

Answer:

A

Explanation:

the scientist always makes a hypothesis

Without the process of translation, our cells would not be able to:
make DNA
make RNA
make amino acids
make proteins

Answers

Answer:

Make protein

Explanation:

Make protein by RNA

The space shuttle leaves the surface of the earth and reaches a height of 50,000 kilometers in 25 seconds. What is the average speed of the shuttle during this journey?
Select one:
200,000 km/s
20,000 km/s
200 km/s
2,000 km/s

Answers

Answer:

2000 km/s

Explanation:

the formula for speed is speed=distance/time, this is the formula that should be used here. 50,000/25, which equals 2,000

2,000 km/s because i’m sorry the other person said it

what is a similarity of an ecosystem and a habitat

Answers

Answer:

Habitat and ecosystem are two ecological terms.Both include living organisms. Organisms live in both systems.

Hope this helps!

Answer:

Both include living organisms. Organisms live in both systems

Explanation:

Answered by NONE other than the #QUEEN herself aka #DRIPPQUEENMO

HOPED THIS HELPED!!

which two layers of the atmosphere are responsible for the majority of solar radiation absorption?

Answers

Answer:

The stratosphere and thermosphere.

Explanation:

the stratosphere and the thermosphere

Describe the difference between primary succession and secondary succession. (Be sure to use the vocabulary terms: climax community and pioneer species in your description. Also include a general
time frame for each event)

Answers

Answer:

Explanation: Primary means that it was from thAT TIME PERIOD AND SECONDARY MEANS YEARS AFTER THAT TIme period.

Shawn explains that many studies have shown that directly spraying bees with fungicides doesn't harm them. Are those results consistent with what Shawn has discovered? Explain your answer in a few sentences.

Answers

Answer:

Yes.

Explanation:

Yes, the results will be consistent of spraying bees with fungicides because the fungicides affect the growth of fungus not the bees. fungicides  are the chemicals kills fungal growth while on the other hand, insecticides will kill the insects such as ants, bees etc. If the Shawn apply insecticide on the bees, it will kill the bees due to its effectiveness so that's why the results of the directly spraying bees with fungicides will always be consistent due to its ineffectiveness.

point) A student examines a cell under the microscope and observes that the cell contains many mitochondria. This is evidence that the cell uses lots of
a,lipids
b,protein
c,energy
d,DNA ​

Answers

Answer:

Answer: mitochondrios produce energy from glucose, and c might be wrong dont be mad at me

Explanation:

Answer: mitochondrios produce energy from glucose, also C is right

Rising water vapor that meets cold air and turns into water
droplets is known as:
a. dehydration
b. evaporation
c. precipitation
d. condensation

Answers

Answer:

D

Explanation:

Humans, and other animals, exhale
A. oxygen

B. natural gas

C. carbon dioxide

D. cytoplasm

Answers

Answer:

C

Explanation:

Humans,and other animals,exhale carbon dioxide and inhale oxygen.

Answer:

c: humand and animals exhale carbon dioxide

which statement is correct about the relationship between plants and animals

A.) plants depend only on food
B.) animals depend only on plants for food
C.) plants do not depend on animals to survive
D.) plants and animals depend on matter produced by the other to survive

Answers

Answer:

hm id say D tell me if im wrong

Answer:

D

heres why because how do we breath plants and some plants are food.

Angela set out to determine how many genes
control the length of people's eyelashes. She
compared the length of eyelashes from 12 different
people. She measured each person's eyelash by
placing the eyelash on a metric ruler and measuring
the length directly.
What is a possible source of error in her
experiment?
A. She did not collect data from enough
people.
O B. She should have considered the number of
eyelashes on each eyelid in her data
collection.
O C. She may have had a difficult time making
accurate measurements directly.
O D. She did not include a control group.

Answers

The statement 'she did not collect data from enough people' is a source of error in an experiment (Option A).

What is the N sample?

The N sample refers to the number of objects and/or persons tested during an experimental procedure.

The N sample is fundamental for eliminating the source of variation that may lead to errors.

These errors are a consequence of faulty testing of a suitable number (N) sample.

In conclusion, the statement 'she did not collect data from enough people' is a source of error in an experiment (Option A).

Learn more in:

https://brainly.com/question/14470673

Please answer ASAP! My teacher just assigned this today, and it is due in an hour..I have about 30 questions to finish :(
Why are organisms in lower parts of the food chain not affected but organisms at the top of the food chain are?

Answers

Answer:

the organisms at the top of the food chain are effected because theyre bigger and the need more food and prey to survive. for example sharks, if fish arent thriving because they arent eating enough from the bottom of the food chain, the sharks cant eat them and the sharks will starve.

Explanation:

Answer:

The organisms at the bottom of the food chain have a tendency of reproducing faster. (unlike the top of the food chain). Don't think that the the organisms at the bottom of the food chain are not as important though! Everything is important in any food chain!

Can you please help me

Answers

The answer would be A

An earthquake causes a population of 10 deer with long tails to panic and move to a
population of 90 deer with short tails. Over time, the allele frequency for long tails
increases from 10% to 30%.
Match this scenario to its mechanism of evolution.

Answers

Answer:gene flow

Explanation:

Plants use energy from sunlight, water, and carbon dioxide to produce sugar. Which structure is found only in plant cells and helps plants capture energy from sunlight?

A. vacuole
B. nucleus
C. chloroplast
D. cell membrane

Answers

C. Chloroplast
I remember it like this, chlorophyll is the thing that makes the plant green. And chloroplast sounds just like it. So chloroplast is found in plants.

Answer:

The Answer is C. Chloroplast

Explanation:

Chloroplasts are the organelle of photosynthesis. They capture light energy from the sun and use it with water and carbon dioxide to make food (sugar) for the plant. The arrangement of chloroplasts in a plant's cells can be seen in Figure below.

The transfer of heat is responsible for many of the events that occur on Earth. Which of the following events is most directly caused by radiation from the Sun?

the circulation of air

the warming of Earth’s surface

the movement of ocean currents

the movement within Earth’s mantle

Answers

Answer:

the circulation of air

Explanation:

air is from a sun

which reproduction uses non reproductive plants of a plant to produce new plants​

Answers

Answer:

Vegetative propagation

Explanation:

Vegetative propagation does not require seeds or spores. Instead, offspring grow from a part of the parent plant.

Why do cells need to undergo meiosis

Answers

Answer:

Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells. This process is required to produce egg and sperm cells for sexual reproduction. ... Meiosis begins following one round of DNA replication in cells in the male or female sex organs.

Some suggestions for measures that the United States can implement to avoid contributing to greenhouse gases!

Answers

Answer:

1. Increase the use of green renewable energies  

2. Promote recycling  

3. Controlling industrial greenhouse CO2 emissions from the transportation sector  

4. encourage the use of non-polluting means of transport (e.g., walking over road transport)

Explanation:

First, renewable energies are energy sources generated naturally without the use of fossil fuels (e.g., solar energy, wind energy, geothermal energy, etc). Thus, these green energies can replace the use of fossil fuels in a sustainable manner, and therefore reduce the emission of greenhouse gases such as carbon dioxide (CO2). Second, recycling can drastically reduce the amount of energy required to synthesize new products and reduces the need for new materials, being thus also useful to reduce CO2 emissions that result from extracting virgin materials. Third, the industries from the transportation sector produce the largest part of greenhouse gas emissions, thereby encourage the use of green energies in this area may represent a good alternative to reduce CO2 emissions. Finally, it is well known that urban transport generates about 40% of all CO2 generated by road transport, and thereby invest in green transport systems such as bicycling and walking may also represent a useful strategy to reduce CO2 emissions.

plant that lacks true roots,sterms and leaves​

Answers

Bryophytes have no roots, leaves or stems.

Answer:

Bryophytes is the answer :)

Explanation:

What is not a function of the atmosphere?

Answers

Answer:

the function of atmosohere is protectibe and sbsorbs

Explanation:

Protective functions of the Atmosphere Absorbs and interacts with harmful electromagnetic radiation and stream of charged particles.

I mark you brainiest just please answer this question for me please

Answers

Answer:

It is C, To fill the space between the cell membrane and the nucleus.

Explanation:

I hope this helps! Have a great rest of your day!

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

is planting trees in a forest In an investigation into the role of plants in the cycling of matter, a researcher is designing an experiment in which plants will be grown under conditions that will limit the rate of photosynthesis. Which design would match the goal of the researcher? M. Grow the plants in a low oxygen environment and measure the rate of carbon dioxide production. P. Grow the plants in a low carbon dioxide environment and measure the rate of oxygen production. R. Grow the plants in soil containing excess water and measure the rate of transpiration. S. Grow the plants in soil containing excess nitrogen and measure the rate of plant growth. Bi​

Answers

Answer:

S

Explanation:

The growth of plant can be measured using the starch produced.

Which sequence furthers scientific knowledge? Hypotheses generate a scientific question, leading to observations, which can be tested through an experiment. Observations generate a scientific question, leading to a hypothesis, which can be tested through an experiment. Hypotheses generate a scientific experiment, leading to observations, which can be tested through a question. Observations generate a scientific experiment, leading to a hypothesis, which can be tested through a question.

Answers

Answer:

The correct answer is - Observations generate a scientific question, leading to a hypothesis, which can be tested through an experiment.

Explanation:

In any scientific knowledge development process, scientists need to follow the scientific process in a particular sequence that helps in developing and testing a hypothesis.

The sequence has:

observation: Observation requires you to pay attention to occurrences around

Forming question: on the basis of observation form a question about why that occurrence happens.

Hypothesis formation: The hypothesis is your initial prediction on why that happens.

Experiment: The experiment is being done in order to collect data and analysis so you can test your hypothesis

Answer:

Its b

Ur welcmom

Drag one of the nucleotides to a corresponding nitrogenous base on one of the two strands. What is
the role of DNA polymerase in this process?

Answers

Answer:

This enzyme is responsible for the production of DNA molecules from RNA molecules.

Explanation:

DNA polymerase is a type of enzyme that produces DNA molecules from RNA molecules. The enzymes play a vital role in the replication of DNA in which the enzyme produces two identical copies of DNA from one original DNA molecule. This replication of DNA is very important for cell division as well as growth of the organisms. Without this replication, no mitosis occurs in the body that leads to no growth of the organism so we can say that this enzyme plays a great role in growth of an organism.

The process of the formation of the new from the old DNA is called is replication.

The enzyme responsible for the formation of DNA replication is DNA polymerase.

The things required in the formation of new DNA is as follows:-

DNADNA polymeraseDNA ligase

The function of the DNA polymerase during the time of DNA replication is to get the nucleotide as a monomer to join together by the DNA ligase. The nucleotide joins together in the 5' to 3' direction.

The drag of one nucleotide from the sequence leads to the mutation. These lead to the form of the infected protein and form the abnormal character.

For more information, refer to the link:-

https://brainly.com/question/25305623

Other Questions
Identify the propaganda used in the following advertisement What is the exact area of a regular hexagon with a side length of 8 cm? Enter your answer in the box. cm Help please asap will mark brainliest ! Which two consecutive integers does -138 lie between?A:11 and 12B:12 and 13C:-11 and -12D:-12 and -13 If anyone that is fluent in Spanish can help me out with this work that'd be much appreciated. (100 PTS) help me and Ill give you brainliest In which quadrant would you find the point (5, -6) pleassse help meeee, According to "Barrington Irving, Pilot and Educator," what is the main goal of Irving's nonprofit organization, Experience Aviation? Hi does anyone done this before please help me thank you sooooo much Please help again! Ill give brainleast to whoever gives correct answer! What is the probability of choosing a clubs or a numbered card from a deck of cards? Type your answer as a fraction. Complete the sentences with the correct form of the verb ir to say where the people are going.Eduardo _____ al gimnasio a levantar pesas. Sofia has 25 coins in nickels and dimes in her pocket for a total of $1.65. How many of each type of coin does she have? 7. Examine Diagram Two. which represents the rock layers in one specific area. What can the types if organisms present in each layer tell you about how this environment has changed over time? Explain your answer. What is the answer to this question?(3+5)^2 Linda needs 6/9 cup of strawberries and 3/4 cup mashed peach for a recipe. She wants to find whether she needs more peaches or strawberries. How can you write 6/9 and 3/4 as a pair of fractions with a common denominator? increase 140 in the ratio 7:5. This is the answer of the volume of a prism A is 60 cubic units, and the volume of prism B is half the volume of the prism and the value of a is 2.5 An unknown number y is 15 more than an unknown number x. The number y is also x less than 8. The equations to find x and y are shown below.y = x + 15y = x + 8Which of the following statements is a correct step to find x and y?and could somebody please give me a step by step explanation