Use the what you learned area to fill in the blanks.

Use The What You Learned Area To Fill In The Blanks.

Answers

Answer 1

Answer:

1. cardiac muscle .

2. skeletal muscle .

3. smooth muscle .

4. your heart .

5. bones .

6. stomach .

7. muscle fibers .

8. non-striated muscle .

9. cardiac muscle tissue is only found in your heart .

10. exercising, getting enough rest, and eating a balanced diet will help to keep your muscles healthy for life .

11. wrong diet , consume fewer calories and eat a lower percentage of foods that are high in proteins and carbohydrates , weight training , if you're continuing to train with weights, use lighter weights and reduce weight training frequency to no more than 2 times per week to maintain tone , cardio , not warming up etc .

Explanation:


Related Questions

Do you think that photochemical smog levels are high during the winter or during the summer? Explain.

Answers

Answer:

Use this: I think the photochemical smog levels are higher during the summer do to the increase in car usage and pollution. Studies show that more people use cars in the summer. In addition, the hot, musty, humid air in the summer can significantly increase pollution effect.

Explanation:

The equator is at a latitude of 0°. Which latitude will have the warmest temperature?

Answers

Answer:

There is a relationship between latitude and temperature around the world, as temperatures are typically warmer approaching the Equator and cooler approaching the Poles. There are variations, though, as other factors such as elevation, ocean currents, and precipitation affect climate patterns.

Explanation:

0 will have warmest

How can wind and water change the materials on earth's surface? (Specifically, rocks/the geophere) ​

Answers

When mechanical and chemical weathering breaks up materials on the Earth's surface, erosion can move them to new locations. For example, wind, water or ice can create a valley by removing material. ... When layers of eroded material pile up, it's called deposition. This can create new landforms.

QUestion 6 and 7
6. What are the three main roles of an ecosystem?

7. What is the purpose of a decomposer in an ecosystem?

Answers

#6: The living organisms in an ecosystem can be divided into three categories: producers, consumers and decomposers. They are all important parts of an ecosystem.

#7: Nature has its own recycling system: a group of organisms called decomposers. Decomposers feed on dead things: dead plant materials such as leaf litter and wood, animal carcasses, and feces. They perform a valuable service as Earth's cleanup crew

HOPE THIS HELPS

#7 decompsers eat on the dead. without decomposers dead leaves, dead animals and dead insects would pile up everywhere

Question: Describe how a river changes the earth´s surface. please explain in your own words, might be reported if answer is c o p y r i g h t

Answers

Answer:

Answer down below

Explanation:

Through the processes of erosion and deposition, rivers and streams can drastically alter the Earth's surface. ... The rushing water of rivers helps to carve new features into the surface of the Earth.

Hello
Hope u r fine in this pandemic
Answer is
That water helps deposit nutritions from mountains to plains to make em fertile (water here refers river streams etc.)

Write a paragraph on why food needs to be digested. :)

Please hurry I need it.

Answers

Answer: You die if no digest

Explanation:

Food needs to be digested because your body can't contain large stuff whole, so it has to be converted into a smaller amount. For Instance, if you were to eat a entire turkey then your body would just explode I guess if you wouldn't digest it. Also, without digesting food you can't enter new food into your body. Therefore, this is why food needs to be digested.

Im sorry if my answer is two short but you can expand or take the idea of it.

Food needs to be digested into tiny particles in order for your body to absorb its nutrients and convert it to energy.

If the last three animals of a species are all females, what will happen to the species?


A
The species population will slowly grow +

B
The species will become extinct because it takes a male and a female to reproduce -

C
The species will not change /

Answers

The best answer to go with is b

In an ecosystem, if the last three animals of a species are all females, the species will become extinct because it takes a male and a female to reproduce .

What is an ecosystem?

Ecosystem is defined as a system which consists of all living organisms and the physical components with which the living beings interact. The abiotic and biotic components are linked to each other through nutrient cycles and flow of energy.

Energy enters the system through the process of photosynthesis .Animals play an important role in transfer of energy as they feed on each other.As a result of this transfer of matter and energy takes place through the system .Living organisms also influence the quantity of biomass present.By decomposition of dead plants and animals by microbes nutrients are released back in to the soil.

Learn more about ecosystem,here:

https://brainly.com/question/1673533

#SPJ6

QUESTION 2
2. How would you describe an ecosystem?

Answers

Answer: An ecosystem is a geographic area where plants, animals, and other organisms, as well as weather and landscape, work together to form a bubble of life. Ecosystems contain biotic or living, parts, as well as abiotic factors, or nonliving parts

HOPE THIS HELPS

A student uses a lever and fulcrum to lift a rock off the ground.

Which option describes when potential energy is converted into kinetic energy during this process?


a. when the lever is wedged beneath the rock but before it has been lifted

b. when the student presses down on one side of the lever to cause it to move

c. when the rock rests on the ground without the lever

d. when the rock rests above the ground

Answers

Answer:B

Explanation: I know this because kinetic energy is when something is moving and potential energy is when something is not moving and the energy is being stored so it has you are pushing on the other side moving the object it is transforming the potential energy also known as stored energy into movement also known as kinetic energy

B is the correct answer

What is the function of tunnels and passageways in subsurface mining?
a. to reach mineral ore deep below the surface of the earth
b. to reach mineral ores on the surface of the earth
c. to drain underground lakes where minerals are found
d. to create strip mines and quarries below the surface of the earth

Answers

Answer: to reach mineral ores on the surface of earth

Explanation:

ANSWER: b. to reach mineral ores on the surface of the earth

Please help!!!!!!!!! Which word goes here and means composed of one element??!!

Answers

Answer:

Pure-Substance

Explanation:

Answer:

Pure-Substance

Explanation:

I'm just answering so you can give the other person Brainlyest.

Which two organisms share the least number of derived characteristics?

Frog and kangaroo
Kangaroo and chimpanzee
Lion and chimpanzee
Shark and chimpanzee

Answers

Shark and champanzee

Answer:shark And chimpanzee

Explanation:

Both of them are less Similar than the others because the others live on land in sharks live in water and most of their characteristics are very different

Which best explains how a single-celled organism can survive without other cells?

Answers

Answer:

They are able to perform all necessary functions within one cell.

Explanation:

They do not need to perform more than one function to survive. They are able to perform all necessary functions within one cell. They are able to perform all necessary functions within one cell.

Please help. (science question)

Answers

Answer:water  erodes the earth by passing over rock and thinngs many times, as in a river, the water slowly washes away the rock turning it into sediment or silt.

Explanation:

Answer:Hope this helps :) if so pleas could you mark brainliest:) enjoy!

Explanation:

The cycle of water erosion has been here since forever thanks to the rain rivers, ponds lakes, the sea and the ocean because it first starts off with the rain then the rain fills up the lakes and pond and start rivers and the rivers lead to the sea and ocean and from there the water evaperates then it rains again and the lakes and ponds help with the evaporation.

Which of these are vestigial structures?
A. the sharp spines of a cactus
B. the wings of a butterfly
C. the hip bones found in some spees of snake
D. the thick fur and layer of fat of some mammals in cold climates

Answers

Answer:

your answer is C

Explanation:

La respuesta es c lo que el dijo

Please help me with this science question

Answers

a glacier is a block of ice

. Which statement describes the difference between an independent and dependent variable? a. The dependent variable changes based on the independent variable.
b. The dependent variable is the control, and the independent variable is the result.
c. The dependent variable does not change, and the independent variable does change.
d. The independent variable does not change, and the dependent variable does not change.

Answers

Answer:

A

Explanation:

The independent variable only changes when whoever is conducting the experiment changes it, When it does change, it changes the dependent variable

The answer is A i had a question very similar to this

15 points?
Extinction of a species is most likely to NOT occur in which example?
A. the organism is larger and stronger than others in it's environment
B. the organism is smaller and smarter than others in its environment
C. the organism is larger and smarter than others in it's environment
D. the organism is able to survive and reproduce more than others in it's environment

Answers

Answer:

D. the organism is able to survive and reproduce more than others in it's environment

Explanation:

It will only go extinct if it can't survive or reproduce.

D. Because extinction=Something being extension/bye-bye

Which distinguishes a dwarf planet from a planet?

Answers

Answer:

It's size

Explanation:

The definition of a dwarf planet is "a celestial body that orbits the sun and has a spherical shape but is not large enough to disturb other objects from its orbit"

Essentially, "dwarf" is an adjective. Just like saying the colour distinguishes a purple planet...

dwarf = too small to be a planet

If high tide occurs at 6:00 am, when will the next high tide occur?

Answers

High tides occur 12 hours and 2 minutes apart do it would be at 6:25 pm
At 6:25 tell me if you need an explanation

please help me with these science questions

Answers

Answer:

1. arches commonly form where inland cliffs, coastal cliffs, fins or stacks are from the sea, rivers or the weather. 2. yellowish brown loamy/foamy deposit found in North America, Europe, and Asia!

Answer the following questions with a picture only PLEASEEEEE.

1. What is the main source of energy for ecosystems?

2. What are some natural things that can disturb ecosystems?

Answers

Answer:

1.Photosynthesis is the process of converting light into energy

2.Natural events, such as wind, drought, flood, fire, or disease.

Explanation:

1.Since photosynthesis converts light into C-H bonds in organic material, photosynthesis is the most common source of energy in most habitats, and therefore carbon flow and destiny are inextricably related to energy flow.

2.Natural disasters such as wind, drought, storm, burning, or disease may cause disruption. These "natural occurrences" are often linked to human activities. Air and water emissions, as well as climate change effects such as temperature, rainfall, and ocean chemistry, are also examples of human disruptions.

(hope this helps can i plz have brainlist :D hehe)

1.In this environment, which trait is adaptive for the birds


2. Did the birds choose to have the adaptive trait? (yes or no)

3.Sherman suggests that reproduction always creates individuals with adaptive traits. Does this seem correct? Why or why not?

Answers

Answer:

1.Natural selection is the mode of evolution that makes living things well-suited (adapted) to their environments. This mechanism has sculpted the beaks, feet, and plumage of birds over millions of years, making these animals more successful in their environments.

2.yes

3.

Explanation:

Im sorry only 1, 2 I can answer!

But hope it helps you!

You can report me if you want!

In the presence of light, plants use carbon dioxide and water to produce sugar and oxygen during the process of transpiration.
True or False?

Answers

I believe the answer is true

Please help me with this NO LINKS

Answers

Answer:

d

Explanation:

the moon because moon is following the earth

The object that would be the greatest gravity is the sun

what are 5 things that go through photosynthesis? I have: plants, algae, some microorganisms and cyanobacteria

Answers

Explanation:

This process is called photosynthesis and is performed by all plants, algae, and even some microorganisms. To perform photosynthesis, plants need three things: carbon dioxide, water, and sunlight. for photosynthesis.

Match the following items.
1.
uses a lens to gather and focus light
refracting telescope
2. separates starlight into wavelengths
radio telescopes
3. pick up faint-lighted stars
spectrograph
4. see binary stars
giant refractors
5. see behind nebulae dust
giant reflectors

Answers

Answer:

1-uses a lens to gather and focus light- giant reflectors

2-separates starlight into wavelengths- spectrograph

3-pick up faint-lighted stars- radio telescope

4-see binary stars- refracting telescope

5-see behind nebulae dust- giant refractors

Explanation:

is it correct?

I will mark brainlist for best awnser
Imagine that all the plants in a particular area died. Which best predicts what would happen to the animals in that area? Choose the prediction that best matches your thinking. (write a paragraph explaining why you chose that answer.)

A. The animals that eat plants would all die. The animals that eat only animals would live.

B. Some of the plant-eating animals would die. Other would live by switching to eat other animals.

C. All of the animals would eventually run out of food and die.

D. All of the animals would survive by eating other foods.

Explain why you selected the prediction.

Answers

C) All of the animals would eventually run out of food and die.

Mark with crown please!
C is your answer I’m sure

^﹏^ Please help!

Write a paragraph on why our food has to be digested.

Paragraph has to have full explanation and complete sentences.

Thank you for your time! ^﹏^

Answers

Digestion is important because your body needs nutrients from food and drink to work properly and stay healthy. Proteins, fats, carbohydrates, vitamins link, minerals link, and water are nutrients. The digestive system is a series of hollow organs joined in a long, twisting tube from the mouth to the anus. When we eat such things as bread, meat, and vegetables, they are not in a form that the body can use as nourishment. Our food and drink must be changed into smaller molecules of nutrients before they can be absorbed into the blood and carried to cells throughout the body. Digestion is the process by which food and drink are broken down into their smallest parts so that the body can use them to build and nourish cells and to provide energy.

20 Points and Brainliest if you answer in 5 mins
Huan made a chart to study for an exam about radio waves.
under column X
Changes the frequency of a wave
is used by cell phones to transmit data
Under Column Y
changes the height of a wave
is used by television stations for pictures
Which headings best complete the chart?

A) X: Phase, Y: Pulse
B) X: Pulse, Y: Phase
C) X: AM, Y: FM
D) X: FM, Y: AM

Answers

The correct answer is D) X: FM, Y: AM

In the electromagnetic spectrum, the headings which best describe the chart are  X: FM, Y: AM.

What is electromagnetic spectrum?

The electromagnetic radiation consists of waves made up of electromagnetic field which are capable of propogating through space and carry the radiant electromagnetic energy.

The radiation are composed of electromagnetic waves which are synchronized oscillations of electric and magnetic fields . They are created due to change which is periodic in electric as well as magnetic fields.

In vacuum ,all the electromagnetic waves travel at the same speed that is with the speed of air.The position of an electromagnetic wave in an electromagnetic spectrum is characterized by it's frequency or wavelength.They are emitted by electrically charged particles which undergo acceleration and subsequently interact with other charged particles.

Learn more about electromagnetic spectrum,here:

https://brainly.com/question/23727978

#SPJ2

Other Questions
why do some scientists believe that humans evolved from apes?a: because fossil records show homologous structures indicating a common ancestor b: because humans and apes lived around the same time period After sitting out of a refrigerator for a while, a turkey at room temperature (69F) isplaced into an oven. The oven temperature is 300F. Newton's Law of Heatingexplains that the temperature of the turkey will increase proportionally to thedifference between the temperature of the turkey and the temperature of the oven, asgiven by the formula below:T = Ta + (T. T.)e-ktTg = the temperature surrounding the objectTo = the initial temperature of the objectt= the time in hoursT = the temperature of the object after t hoursk = decay constantThe turkey reaches the temperature of 127F after 3 hours. Using this information,find the value of k, to the nearest thousandth. Use the resulting equation todetermine the Fahrenheit temperature of the turkey, to the nearest degree, after 5hours.Enter only the final temperature into the input box. Based on what you read about the Compromise of 1850, what would you say was the worst part about it for the future of the United States and why? in 3/4 of an hour Ryan codes 3/5 of his game. at this rate how much of the game can he code in 1 hour The ratio that compares the measurements of a model and the real object is called what? help ASAP For brainlessly what is the complementary DNA of TACCGGATGCCAGATCAAATC? Which transition would best fit in the blank?We need to wash the dishes. ( ), we can go to the county fair.O A. AlthoughO B. After thatC. MeanwhileD. Similarly Relationship break up because of a number of reasons.Name and explain Two factors that contribute to a detrimental relationship? Solve for x given the picture I need an explanationWill mark brainliest Select the correct responses: Cules son los 3 usos de se mencionados en el video?Question 10 options:Los pronombres de doble objetoVerbos como gustarEl "se" impersonalLos pronombres demonstrativosEl "se" transitivoVerbos reflexivos y recprocos Please help me with 1,2,3,4,5,6,7,8,9,10,11 please I really need help explain how the genus and species name of an organism is properly written Explain what benefits you can achieve while performing either exercise? I needddd helppppp !!!whats the answer ? Which linear equation is written in slope-intercept form? Does the timing of a tsunami affect its impact? A 1.5m tall boy casts a 3m shadow. Calculate the height of a tree that simultaneously casts an 8m shadow. Please help choose oneA B C or D??? I have 3 Health questions about babies and pregnancies if any ladies can help me with these questions. Im failing this class and need to majorly bring my grade up. If there are any ladies that can help me with these's questions I'll give them Brainliest. ( Please only answer if you can actually help). I also have English questions to anyone can help with those questions. Im also failing English to. Just click on my name and go to my questions.