NEPTUNE

•Number of days to orbit the sun:
•Distance around the sun:​

Answers

Answer 1

Answer:

1. 165 years

2. 2.781 billion mi

Explanation:


Related Questions

7. A jogger runs three blocks south, two blocks east, 4 blocks north and
two blocks west. What is the DISTANCE the jogger ran? *

Answers

Answer:

11 blocks

Explanation:

distance is adding up the numbers while displacement is the difference in starting and ending points

Stress is __________.
A.
positive or negative, depending on circumstances
B.
a body's automatic physical response
C.
a negative reaction to outside influences
D.
A and B only

Answers

Answer:

(A)

Explanation:

Depending on the circumstances, there are such things called good stress and bad stress.

Alex swims at an average speed of 4.5 m/s how far does he swim in one minute 24 seconds

Answers

Answer:

378

Explanation:

60 seconds in one minute

add the 24 seconds

multiply it by 4.5

60 + 24 = 84

4.5 x 84 = 378

Answer:D 125

Explanation:

3. What is the mass of a falling rock, accelerating at 9.8m/s²?? if it produces a force of 147N?​ PLEASE HELP!! I WILL GIVE BRAINLEST!!!<3

Answers

Answer:

15

Explanation:

Formula

Force = mass × acceleration

147N =? × 9.8 ms2

M =

[tex] \frac{147 }{9.8} [/tex]

M = 15

Double Check

15 X 9.8

147N

Hope this helps!

Which of the following elements is commonly found at the core of an electromagnet?
Lead
Cobalt
Iron

Answers

answer:cobalt
not sure though

Flossie blew a tire 5 minutes into the second leg, up to that point she had traveled 10 km making her speed 2 km/m. It took 2 minutes to fix her tire. Flossie had to finish within 2 minutes in order to stay even with the evil Mabel. If Flossie had 8 km left what speed will she need to win?

Answers

Answer:

4km/m

Explanation:

She was going at 2km/m, so 2 kilometers per minute. She has 2 minutes therefore she needs to double her rate to 4 kilometers per minute.

Focus Question: How are physical properties used to compare and classify substances?​

Answers

Answer:

Properties that can be determined without changing the composition of a substance are referred to as physical properties. Characteristics such as melting point, boiling point, density, solubility, color, odor, etc. ... Physical and chemical properties can be used to classify a substance as ionic or molecular.

Explanation:

Hope it helps! Correct me if I am wrong!

Dont worry im sure about my answer!

If you dont mind can you please mark me as brainlest?

Its ok if you don't want to!

3. A large crane lifts a 25,000 kg mass in the air. The amount of work that must be done by the
crane's lifting components is 2.2 X 10'J (Wo). If the efficiency of the crane is 22%, how much
useful work is done on the mass (Wou)?

Answers

[tex]\mathfrak{\huge{\orange{\underline{\underline{AnSwEr:-}}}}}[/tex]

Actually Welcome to the concept of Efficiency.

Here we can see that, the Input work is given as 2.2 x 10^7 J and the efficiency is given as 22%

The efficiency is => 22% => 22/100.

so we get as,

E = W(output) /W(input)

hence, W(output) = E x W(input)

so we get as,

W(output) = (22/100) x 2.2 x 10^7

=> W(output) = 0.22 x 2.2 x 10^7 => 0.484 x 10^7

hence, W(output) = 4.84 x 10^6 J

The useful work done on the mass is 4.84 x 10^6 J

If it takes 35J to lift up an object to some height, then how much gravitational potential energy will that object have?

Answers

35j because if it takes so much to lift it’s that much pullin down

Compute the force on each of two electrons when they are seperated in vaccum by a distance corresponding to the approximate size of an ato. (0.100nm)

Answers

Answer:

2.304 × 10^-28 N

Explanation:

Compute the force on each of two electrons when they are seperated in vaccum by a distance corresponding to the approximate size of an ato. (0.100nm)

Solution

The formula to use is

F = K Qq / r^2

Substitute all the parameters

F = 9 × 10^9 × (1.6 × 10^-19)^2 / (0.1 × 10^-9)^2

F = 2.304 × 10^-28 / 1 × 10^-10

F = 2.304 × 10^-18 N

Therefore, the force between each of the electron is 2.304 × 10^-18 N

Ingrid says that a red ball of clay appears red because the clay reflects red wavelengths. Simon says that the clay appears red because it allows red wavelengths to pass through it.

Which statement best explains who is correct?

Ingrid is correct. The clay appears red because it reflects red wavelengths.
Ingrid is correct. The clay appears red because it is a type of matter.
Simon is correct. The clay appears red because it allows red wavelengths to pass through it.
Simon is correct. The clay appears red because it is a solid.

Answers

Answer: (A) Ingrid is incorrect. The clay appears red because it reflects red wavelengths.

Explanation:

Edge 2021

Ingrid is correct. The clay appears red because it reflects red wavelengths.

Hence option A is correct.

What is wave ?

Wave is is a disturbance in a medium that carries energy as well as momentum . wave is characterized by amplitude, wavelength and phase. Amplitude is the greatest distance that the particles are vibrating. especially a sound or radio wave, moves up and down. Amplitude is a measure of loudness of a sound wave. More amplitude means more loud is the sound wave.

Wavelength is the distance between two points on the wave which are in same phase. Phase is the position of a wave at a point at time t on a waveform.

There are two types of the wave longitudinal wave and transverse wave.

Longitudinal wave : in which, vibration of the medium (particle) is parallel to propagation of the wave. Sound wave is a longitudinal wave. Transverse wave : in which, vibration of the medium (particle) is perpendicular to propagation of the wave. Light wave is a Transverse wave.

Ingrid says that a red ball of clay appears red because the clay reflects red wavelengths. this statement is true.

Hence option A is correct.

To know more about absorption :

https://brainly.com/question/3080788

#SPJ7.

How much time will it take for a coyote to travel 48 meters across the field to get to the unsuspecting rabbit eating grass in the field? He is travelling at 4 m/s

Answers

formula for time
t=d/s
so…
t= 48m/4m/s
the two ms cancel each other out and ur left with s

t=12s

A wave is moving between two mediums, as shown in the diagram below. The
wave is slowing down and changing directions. What wave property is
illustrated?
A. Refraction
B. Resonance
C. Diffraction
D. Reflection

Answers

Answer:

Uhm i think its a

Explanation:

srry if i get it wrong ._. my bad

Answer:

the correct answer is A

One major concern of acid rain is that it can -
A. change the pH of soil and lakes
B. burn holes in the skin of humans and animals
C. it makes vegetation grow out of control
D. it turns trees red

Answers

Answer:

C. it makes vegetation grow out of control

Explanation:

please mark this answer as brainliest

A machine designed to stretch a stiff spring uses 1,550 J of energy to stretch the spring. If the work output is 1,200 J, what is the machine’s efficiency?

Answers

Answer:

77%

Explanation:

efficiency= work output/work input X 100%

e = 1,200j/ 1,550 j x100%

e = 1,200/1,550= 0.77

e = 0.77 x 100%

e = 77%

What does it take to be classified as a rouge wave

Answers

Answer: A 'rogue wave' is large, unexpected, and dangerous.

At the time, surface winds were light at 15 knots. ... Most reports of extreme storm waves say they look like "walls of water." They are often steep-sided with unusually deep troughs.

Explanation:

Answer:

Rogues, called 'extreme storm waves' by scientists, are those waves which are greater than twice the size of surrounding waves, are very unpredictable, and often come unexpectedly from directions other than prevailing wind and waves.

Electromagnetic radiation travels as
1.
a torsional wave
2.
a longitudinal wave
3.
a transverse wave
4.
an elliptical wave

Answers

2 I hope it help sorry if it is wrong

A man lifts a 5 Newton bag of groceries
from the floor to the top of the countertop,
which is 1.1 meters tall. What is the work
done by this person in lifting groceries?

5
5.5
4.5
6

Answers

Answer:

5.5 J

Explanation:

W=F*D=5*1.1=5.5 J

Using ideas of forces explain why the parachutist reaches terminal velocity and why opening the parachute reduces the terminal velocity

Answers

Don’t download the file it’s a virus

What is one benefit of a cardio kickboxing workout?
A. It is a total body exercise.
B. It focuses specifically on aerobics.
C. It focuses specifically on anaerobics.
D. It focuses on the core muscles.

Answers

Answer:

D. It focuses on the core muscles

Answer:

A. It is a total body exercise

Explanation:

In cardio kickboxing as described by my school is "

a total body exercise that combines aerobic and anaerobic workoutsan improvement in body fat compositionan efficient use of workout timea boost in confidence and self-esteemrelief of stress and increased energy levelsvaluable self-defense skills

The first benefit is the one which we are focusing on because all the other answers are correct but A. Total body exercise is the best answer because it covers all of them as an compendious answer

Also I took the test and got this correct

I’m offering 15 points for this 1 multiple choice question. The answer is not D. Pls answer, though I think I know the the answer, but I just want to make sure.

Answers

Answer:

I wanna say C

Explanation:

because A would be getting it nowhere and B would just take more time but when you use C it would be the greatest force.

Can some one help me ;-;

Answers

Answer: The first answer for the first problem, and the 2nd answer for the second problem

Explanation: For the first one, if it is absolute zero, the molecules would not move at all.

For the second one, the temperature of the sample will increase due to the movement.

Question 5 of 10
What happens when a loop of wire turns between two permanent magnets in
a generator?
A. A current flows through the loop of wire.
O B. Electrical energy transforms into mechanical energy.
O C. A current flows through the permanent magnets.
D. Mechanical energy transforms into electromagnetic radiation.

Answers

Answer:

B. Electrical energy transforms into mechanical energy.

Explanation:

In the case when the wire loop transforms between the two permanent magnets in a generator so here the electrical energy turns to mechanical energy as there is a working principle behind the generator that the electrical energy would turns into mechanical energy

Therefore as per the given scenario, the option b is correct

And, the rest of the options are wrong

A KG object has a speed of 24 M/S if it has 14 J of kinetic energy what is the mass

Answers

k.E=1/2mV2
14=1/2 m(24)^2
14=m576/2
14*2=m576
28/576=m
m=0.048 kg

What kind of energy does an electromagnet use to pick up metallic objects?

Answers

Answer:

Magnetic energy is used by an electromagnet  to pick up metallic objects

Explanation:

An electromagnet generates its own magnetic field in presence of electric current.

As an electric current is induced in an electromagnet , it  magnetic dipole arrange themselves in order to behave as a magnet and hence generate magnetic field with a proper north and south. This leads to attraction of metallic object.

Hence, it can be said that Magnetic energy is used by an electromagnet  to pick up metallic objects

Help hurry help pls it’s timed

Answers

I think it's the yellow one

Which is the best description of a high pressure system?



A.
Air cools and rises.

B.
Air warms and rises.

C.
Air cools and sinks.

D.
Air warms and sinks.

Answers

Answer:

The Answer is gonna be B.

Air warms and rises.

When light hits a second transparent medium, light-

A. Reflects and Refracts
B. Refracts only
C. Reflects only

Answers

Answer:

C. Reflects only

IF SOMEONE CAN'T FIND THE ANSWER I WILL COMMIT ARSON PLEASE HELP MEE
Brainliest + random amount of points please help me It's a crossword

Answers

Answer:

Freefall

Explanation:

Hi the answer is freefall, hope this helps :)

Which of the following statements is true with
regards to Blackbody radiation?
a)
b)
c)
A blackbody emits more energy at longer
wavelengths as it heats up
A blackbody emits energy at all wavelengths
The shape of the blackbody spectrum
depends on what the source is made of
All of the above
None of the above
00)
e)​

Answers

I believe that it most likely would be C,
Other Questions
What is 1.827 rounded to the nearest tenth Which molecule is produced in the aerobic breakdown of a glucose molecule?A. WaterB. OxygenC. LightD. AlcoholE. NADPH Pushing a baby on a swing is easier than pushing an adult on the same swing. Water spills from a glass carried by someone who is walking steadily and suddenly stops short. When thrown with the same force, a soccer ball accelerates more than a bowling ball. A magician pulls a tablecloth out from under a dish on a table without disturbing the dish. A rocket launches into space, pushing fuel exhaust in one direction and the rocket in the opposite direction. A book rests on top of a shelf and does not move until a student accidentally knocks it off. CO Use the following coordinate plane to write the ordered pair for each point Maria has 3 more than Jose. If Jose has x dollars, how much money do they havetogether? What are the five main phases of the cell cycle? What are the main events in each? I need help with this question on IXL Locations with extreme climates and few resources tend to have lower populations. True or False? Can someone pleaseeee help and if youre correct ill give brainliest Can someone please help me!?WILL MARK BRAINLIEST :) I NEED HELP ASAP!!!!!!! will give brainliest How does the content of the passage reflect the author's point of view?A. It shows that the author feels hopeless about the fate of our planet.B. It provides facts and statistics showing that the problem of water shortages is growing.C. It shows that the author dislikes the fact that cities are growing faster in the southwest than elsewhere.D. It shows that the author approves of ongoing scientific research. How was Benjamin Franklin similar to Enlightenment thinkers? The path of a rope bridge can be modeled by a quadratic equation h(l), where h is the height at a point on the bridge relative to the two ends of the bridge and l is the distance from one end of the bridge. One such bridge connects two ends that are 24 meters apart. The lowest point of the bridge is 3 meters lower than the two ends of the bridge Assuming the two ends of the bridge are at an equal height of h = 0 meters, which of the following graphs could be the graph of h (l)? why do some scientists believe that humans evolved from apes?a: because fossil records show homologous structures indicating a common ancestor b: because humans and apes lived around the same time period After sitting out of a refrigerator for a while, a turkey at room temperature (69F) isplaced into an oven. The oven temperature is 300F. Newton's Law of Heatingexplains that the temperature of the turkey will increase proportionally to thedifference between the temperature of the turkey and the temperature of the oven, asgiven by the formula below:T = Ta + (T. T.)e-ktTg = the temperature surrounding the objectTo = the initial temperature of the objectt= the time in hoursT = the temperature of the object after t hoursk = decay constantThe turkey reaches the temperature of 127F after 3 hours. Using this information,find the value of k, to the nearest thousandth. Use the resulting equation todetermine the Fahrenheit temperature of the turkey, to the nearest degree, after 5hours.Enter only the final temperature into the input box. Based on what you read about the Compromise of 1850, what would you say was the worst part about it for the future of the United States and why? in 3/4 of an hour Ryan codes 3/5 of his game. at this rate how much of the game can he code in 1 hour The ratio that compares the measurements of a model and the real object is called what? help ASAP For brainlessly what is the complementary DNA of TACCGGATGCCAGATCAAATC?