Drag one of the nucleotides to a corresponding nitrogenous base on one of the two strands. What is
the role of DNA polymerase in this process?

Answers

Answer 1

Answer:

This enzyme is responsible for the production of DNA molecules from RNA molecules.

Explanation:

DNA polymerase is a type of enzyme that produces DNA molecules from RNA molecules. The enzymes play a vital role in the replication of DNA in which the enzyme produces two identical copies of DNA from one original DNA molecule. This replication of DNA is very important for cell division as well as growth of the organisms. Without this replication, no mitosis occurs in the body that leads to no growth of the organism so we can say that this enzyme plays a great role in growth of an organism.

Answer 2

The process of the formation of the new from the old DNA is called is replication.

The enzyme responsible for the formation of DNA replication is DNA polymerase.

The things required in the formation of new DNA is as follows:-

DNADNA polymeraseDNA ligase

The function of the DNA polymerase during the time of DNA replication is to get the nucleotide as a monomer to join together by the DNA ligase. The nucleotide joins together in the 5' to 3' direction.

The drag of one nucleotide from the sequence leads to the mutation. These lead to the form of the infected protein and form the abnormal character.

For more information, refer to the link:-

https://brainly.com/question/25305623


Related Questions

A carbon footprint is a measure of the amount of carbon human activities, like using energy, release into the atmosphere. Which activity would help decrease the greatest carbon-releasing activity in US homes? limiting time in hot showers wearing layers of clothing turning off lights when leaving a room unplugging electronics when not in use

Answers

Answer: unplugging electronics when not in use

Explanation:

Carbon footprint is the measure of the amount of carbon liberated into the atmosphere due to human oriented activities like burning of fossil fuels, deforestation, liberation of toxic gases including carbon monoxide and carbon dioxide into the atmosphere by the factors and automobile vehicles. To stop the carbon releasing activity in US homes one must unplug the electronic not in use because electronics consume a lot of electrical energy every day this electrical energy comes from thermal power plants which typically use coal to harness energy the combustion of the coal liberates carbon dioxide and carbon monoxide in the environment so creating pollution and increases the carbon footprint. Little will be the usage of electricity little will be the burning of coal and it will decrease the carbon footprint.

Answer:oml people just be sayin anything these days the real answer is B

Explanation:

1Which of the following animals is a primary consumer?

Answers

cant see the following animals

3. What is a type of asexual reproduction that com-
monly occurs in many species of unicellular pro-
tists? (1) external fertilization (2) tissue regenera-
tion (3) binary fission (4) vegetative propagation

Answers

Answer:

In fission (or binary fission), a parent separates into two or more individuals of about equal size. This type of reproduction is common among single-celled organisms including bacteria, archaea, and unicellular eukaryotes, such as protists and some fungi. The single cell divides into two daughter cells.Aug 17, 2016

Explanation:

the answer is binary fission

i need help with #8, #10 please! whoever helps me, ill give brainliest <3

Answers


1. peripheral nervous system
2. synapse
3.nerve impulse

Please Help I will Mark Branliest for first answer Please

Answers

Answer:

to break down waste and worn-out cell parts

Explanation:

Causes of gonorrhea
Please list 3 causes

Answers

Gonorrhoea is a sexually transmitted infection (STI) caused by bacteria called Neisseria gonorrhoeae or gonococcus. It used to be known as "the clap
Four causes of gonorrhea are;
Vagina
Throat
anus.
female reproductive tract (the fallopian tubes, cervix, and uterus)
sexual contact, including oral, or vaginal intercourse

The use of fossil fuels is a concern because it can lead to which of the following?
O increased runoff
O global warming
O polluted waters
Oeutrophication

Answers

Answer:

O global warming

Explanation:

The use of fossil fuels is a concern because it can lead to global warming.

What is the process of the digestive system?

Answers

Answer:

In terms of processes: ingestion, motility, mechanical digestion, chemical digestion, absorption, and defecation.

In terms of pathway: Mouth, throat, esophagus, stomach, small intestine, large intestine, rectum, and finally the anus.

The Rio Grande River separates Mexico from Texas.

What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion

Answers

Answer:

d I think or b?

Explanation:

water could cause it to form a river and spread over time

I need help please :(

Answers

the correct option is :

A. Some energy is lost to the environment as heat, some is used for reproduction, movement and growth of organisms at that level.

only 10 % of energy that the organism get is transferred to the next trophic level.

What is the main function of leaves?A. Leaves provide support for growth and a place to store food.B. Leaves provide a place for photosynthesis to occur.C. Leaves absorb water and minerals and transport nutrients to the stem.D. Leaves create a barrier that prevents water in the plant's tissues from evaporating

Answers

Answer:

B

Explanation:

The main function of a leaf is to produce food for the plant by photosynthesis.

Answer:  The correct answer is B. Leaves provide a place for photosynthesis to occur.

Explanation:  Confirmed correct.

Cancer cells avoid apoptosis by the inactivation of the _______ suppressor gene .
plz help​

Answers

Cancer cells avoid apoptosis by the inactivation of the Tumor suppressor gene.

A student claims that the only difference between prokaryotic cells and eukaryotic cells is that
eukaryotic cells have a nucleus, but prokaryotic cells do not. What is wrong with this claim?

The description of the cell types is incorrect.

Prokaryotic cells have a nucleus, and eukaryotic cells do not.

The description of the cell types is incorrect. Both prokaryotic and eukaryotic cells have a nucleus.

There is another difference between the cell types. Eukaryotic cells have membrane-bound organelles, but
prokaryotic cells do not.

There is another difference between the cell types. Eukaryotic cells have a cell membrane, but prokaryotic
cells have a cell wall instead.

Answers

Explanation:

Eukaryotic cells:

• There is a well defined nucleus

• They are membrane bounded cell organelles like chloroplast, golgi bodies, mitochondria.

Prokaryotic cells:

• The nucleus are not well defined

• Cell organelles are not bounded by membrane

Why is the success of a mutation dependent on environmental conditions?


PLEASE HELP QUICK!!!

Answers

the mutation can only be passed down in the environment is in the favor of the gene (natural selection)

ex. dark haired mice only surviving on dark lava rock while the white mice on the dark lava rock are getting killed.

An organ that makes and secretes hormones is called a
1] lung
2]gland
3]pancreas
4]thyroid

Answers

Answer: 2]gland brainliest?

Explanation:

_______ Which nutrients should we limit and eat less to promote good health?
a. protein, sugars and total fat
b. sugars, fiber and total fat
c. total fat, cholesterol and sodium

Answers

c. total fat, cholesterol and sodium

I think the correct answer is B or C


What does "reliably" mean in these sentences?

Answers

Answer:

it would be the top right one

Answer:

in a way that can be trusted

Explanation:

hope this helps!

(no reporting nor deleting this.)

Can someone tell me if this is correct

Answers

Answer:

Yes you are correct

Explanation:

Which of the following best describes natural selection?

A. organisms vary in their physical traits, and some are inherited

B. Organisms compete for food and shelter

C. organisms best suited to their environments are most likely to survive and reproduce

D. Organisms produce more offspring than can survive

Answers

Answer: C

Explanation: according to Darwin, out of the vast no of individuals which compete for a place in the world, only those having advantageous variations survive and reproduce
C remember the key word is natural

1- how can prokaryotes be used by humans/professionals?
2- how can eukaryotes be used by humans/professionals?
3- how can digestive system be used by professionals?

Answers

Answer: 1 Fermentation processes, such as brewing, baking, and cheese and butter manufacturing. Chemical manufacturing, such as the production of ethanol, acetone, organic acids, enzymes, and perfumes. Pharmaceuticals, such as the manufacture of antibiotics, vaccines, and steroids. Energy, in the form of biogas (methane)

2 Despite the fact that we have gobs of prokaryotic cells living inside and on us, humans are still categorically eukaryotic organisms. This means that all human cells—including those found in the brain, the heart, the muscles, and so on—are also eukaryotic.

3 Digestion works by moving food through the GI tract. Digestion begins in the mouth with chewing and ends in the small intestine. As food passes through the GI tract, it mixes with digestive juices, causing large molecules of food to break down into smaller molecules.

Explanation:

Worth 26 points! Help me please! Do 1,2,3 by filling in the blank!!!! And I will make you brainest!
And don’t answer just to get points or I am reporting you

and no website

Answers

Answer:

Glucose is the word!!

How much water on Earth is salt water?

Answers

Answer:

97 percent

Explanation:

Science

Answer:

below

Explanation:

Over 97 percent of the earth's water is found in the oceans as salt water. Two percent of the earth's water is stored as fresh water in glaciers, ice caps, and snowy mountain ranges. That leaves only one percent of the earth's water available to us for our daily water supply needs.

HELP right now please! No websites

Answers

Carbon dioxide is the name of the molecule I believe
CO2. Carbon Monoxide

mutations in dna may or may not result in a change in the phenotype of an organism. in which of the following situations will a mutation appear in the phenotype of an individual

Answers

Some mutations don't have any noticeable effect on the phenotype of an organism. This can happen in many situations: perhaps the mutation occurs in a stretch of DNA with no function, or perhaps the mutation occurs in a protein-coding region, but ends up not affecting the amino acid sequence of the protein

The type of mutation which may not result in any chage to the penotype of an organsim is called a silent mutation.

What are mutations?

Mutations refers to the changes that occur in the DNA of an individual organism. These chages may or may not change the appearance (phenotype) of the orgamsim.

The type of mutation which may not result in any chage to the penotype of an organsim is called a silent mutation.

Learn more about mutation:https://brainly.com/question/365923

islfso lufe
(Hint: a non-renewable resource, like coal)
CHAPTER
1 what is the term?

Answers

Answer:

Fossil fuel

Explanation:

Which of the following are characteristics of
Zygomycota? Check all that apply.
D
lack reproduction phase
spores produced in basidia
spores produced in zygosporangia
important in the food industry
important in the fermentation process
can cause disease to plants
can cause disease to animals

Answers

Answer: 3- spores produced in zygosporangia

5- important in the fermentation process

Explanation:

Answer:

in the picture

Explanation:

genes for traits that help an organism be more successful reproductively can be expected to ...

A - cause it to evolve into species

B - eventually be eliminated by natural selection

C - become more common in the future

D- cause the extinction of the species

Answers

C - become more common in the future

Please no links they are not working
Which climate experiences the greatest range in temperature?

A. Taiga
B. Desert
C. Tropical Rainforest
D. Desert and Taiga

Answers

Answer:

C!

Hoped this helped! <3

Chlorophyll is essential to photosynthesis because it traps the _______________ needed. A. oxygen B. carbon dioxide C. sunlight D. water

Answers

Answer:

sunlight

Explanation:

cawg

Answer:

C. sunlight

Have a good day

what can a negative consequence of humans being hunter-gatherers?

A. they needed to stay in one location for food

B. Nate cultivated their own food

C. they had to move around to find food

D. they had to have large families to help on the farm​

Answers

Answer:

C

Explanation:

Other Questions
Based on what you read about the Compromise of 1850, what would you say was the worst part about it for the future of the United States and why? in 3/4 of an hour Ryan codes 3/5 of his game. at this rate how much of the game can he code in 1 hour The ratio that compares the measurements of a model and the real object is called what? help ASAP For brainlessly what is the complementary DNA of TACCGGATGCCAGATCAAATC? Which transition would best fit in the blank?We need to wash the dishes. ( ), we can go to the county fair.O A. AlthoughO B. After thatC. MeanwhileD. Similarly Relationship break up because of a number of reasons.Name and explain Two factors that contribute to a detrimental relationship? Solve for x given the picture I need an explanationWill mark brainliest Select the correct responses: Cules son los 3 usos de se mencionados en el video?Question 10 options:Los pronombres de doble objetoVerbos como gustarEl "se" impersonalLos pronombres demonstrativosEl "se" transitivoVerbos reflexivos y recprocos Please help me with 1,2,3,4,5,6,7,8,9,10,11 please I really need help explain how the genus and species name of an organism is properly written Explain what benefits you can achieve while performing either exercise? I needddd helppppp !!!whats the answer ? Which linear equation is written in slope-intercept form? Does the timing of a tsunami affect its impact? A 1.5m tall boy casts a 3m shadow. Calculate the height of a tree that simultaneously casts an 8m shadow. Please help choose oneA B C or D??? I have 3 Health questions about babies and pregnancies if any ladies can help me with these questions. Im failing this class and need to majorly bring my grade up. If there are any ladies that can help me with these's questions I'll give them Brainliest. ( Please only answer if you can actually help). I also have English questions to anyone can help with those questions. Im also failing English to. Just click on my name and go to my questions. Knives should be stored in cluttered drawers.True or false Consider the Tips for Responsible Financial Decisions discussed in this module. Using some of these tips, what advice would you give Brian on at least one of his financial decisions? How will your advice help Brian reach his financial goal?