Built between 1826 and 1834, Fort Macon is on the coast of North Carolina in the United States. It
was constructed to protect the U.S. coast from foreign invaders. Its installation was spurred by
British invasions in the War of 1812. The only time it was attacked was during the American Civil
War, when it was captured. Later it became a state park.
The building's purpose was
industrial
defensive
artistic
economic

Built Between 1826 And 1834, Fort Macon Is On The Coast Of North Carolina In The United States. Itwas

Answers

Answer 1
I would say defensive because it was during the war against the British

Related Questions

4. Which of the following words communicate a similar meaning and feeling as the word cracks
in the first stanza?
a. opens
b. Splits
c. Pokes
d. Explodes

Answers

AlohaS4

Answer: B) Splits

Explanation: The word "cracks" defined in the dictionary is "a line on the surface of something along which it has split without breaking into separate parts." So, B) Splits, would be the correct answer because splits means, "break or cause to break forcibly into parts, especially into halves or along the grain." Both definitions have something to do with dividing something into multiple parts or such. =3=

Hope you found this helpful, have a good day.

~Aloha

Loremipsumpilokeyuyrhtnujucfghdt

Answers

Answer:

Nice

Explanation:

Answer:

please dont troll on here, people need answers and these type of questions crowd the real ones!

Which phrase best describes how Sharon responds to
the challenge of completing a Tommy Hop?
01. with self-doubt and defeat
O2 with disappointment and fear
03. with steady calm and patience
04. with courage and belief in herself

Answers

I’d say it is number 4, I haven’t read the story but it is just a guess and it is most likely going to be number 4. Sorry if I’m wrong! Good luck!

I really need help with this question

Answers

please do not waste this answer because now only ONE other person can answer. If you do not know the answer please do not answer the question. Thankyou!

Which of the following words is an interjection?

Animated
Forever
Gross
Koala

Answers

gross is an inerjection

Answer:

The answer is C) Gross

Explanation:

Gross =

Ew!Yuck!Ick!

can someone pls help me :))

Answers

Answer:

Subjunctive

Explanation:

Subjunctive verbs are used to express what people wish or imagine to do.

Which of the following is an example of a myth?
Hercules
Robin Hood
Spilling salt
Wishing on a penny

Answers

First answer ( Hercules)

"Hercules" is an example of a myth.Hercules strangles the snakes that Hera puts in his crib.”

What do you mean by Hercules?

Hercules was a hero in Greek mythology. He was the son of Zeus and Alcmene. Hercules was famous for his strength and his adventures. The backstory refers to the background created for a character, specially if this is a fictional one.

According to the myth, Hercules' problems had started before he was born: Hera tried to prevent his birth but Alcmene's servants so Hera put the snakes that Hercules strangled later.

Hence, option A is correct.

Learn more about Hercules, refer to the link:

https://brainly.com/question/16562484

1) Which best describes the point of view of this argument?

Tindell believes that students should only read the

greatest plays by Shakespeare.

Tindell advocates for reading other great Elizabethan

playwrights besides Shakespeare.

Tindell believes that students should not read plays

by Shakespeare in the future anymore.

D)

Tindell thinks that reading some of Shakespeare's

bad plays may help students better appreciate his

greatest works.

Answers

Answer:

The correct option is option B where Tindell advocates for reading other great Elizabethan  playwrights besides Shakespeare.

Explanation:

In order to fully understand the dynamics of Elizabethan era, it is neccessary to have a diverse opinion from different authors. This relates that the only exposure to Shakespeare is not enough for the students to fully understand the era as well as the literature of that time.

Todd found a kite at the store when he and Lisa went scavanging for food. At
first, Lisa told him to put it back, but then told Todd she would make time for kite
flying. Why do you think she told Todd she would make time for that?

Answers

Answer:

Explanation:

what should i do for my room

Answers

Answer:

depends on your aesthetic/room decor style

Explanation:

Answer:

paint it red i hope this helps

how does the conversation with her grandmother in paragraph 17 affect noor​

Answers

Answer:

Makes Noor think about stuff more

Explanation:

20 points. Will give brainliest, thanks, and 5 star review to best answer.
btw, its not letting me give brainliest w only one answer.

This is a major grade for English. I need to write a CER (claim, evidence, reasoning) on "What do these 2 poems(songs) do differently? How do they contrast?

Could someone please give me a few contrasts and a little evidence to start me off? I really need help, please. The songs are ruby's shoes by Lori McKenna and Over the Rainbow from wizard of Oz. I'll put the lyrics in the comments.

Thank you so so much. Please answer soon. This is due today.

Answers

Answer:

I’m noticing here in the first stanza that it says “Ruby’s shoes would take her a mile or so to school every day, where the white Every day, these words remind me that she keeps on, despite the fact that people there are cruel to her.

This demonstrates her determination to continue attending school and learning. I've already noticed that she prays every morning. Every now and then, there's that expression. She would pray because it is difficult for her to go to school in this condition, but she does so every day.  “Well, well, no other child has ever walked in her shoes,” says the author, implying that she is the first student to go through this ordeal. That must have been very difficult for her, but she continues to attend school regardless.

As the author says Ruby's will is higher, she is implying that Ruby will not be scared into not going to school. It follows the poet's description of how white people would show her signs asking her to leave. “She is stronger than the big0ts with the signs will ever know,” says the next paragraph. This demonstrates that she would not display her fear to them. Ruby's determination to attend school triumphs over their hatred and cruelty. She would not allow them to prevent her from turning up. It's as as if she's implying she won't let them win. Her will is her resolve and continue going to school to study despite the fact that others do not want her there.“Ruby stopped and prayed that all the hatred would go away,” the poem states. This line appears four times in total. Why did the author want this particular line to be repeated? What does this reveal about Ruby to the reader? This line is important to the poet, and he wants me to pay attention to it. It's repeated because it reveals something significant about Ruby to me. Every day, Ruby paused to pray, according to the study. The author wants me to see that she continues to do this, over and over. Ruby's use of the word prayed makes me believe she is a devout Christian. This line follows a series of stanzas in which people are cruel to her. It occurs after they have screamed at her and left her stranded in the classroom. She is constantly praying for people to be more compassionate. She does not retaliate or get enraged at the citizens. Instead, she prays for them. This line is repeated by the author so that I can note Ruby's gentleness.

In this poem, there are no periods after any of the lines. Periods cause the reader to avoid reading. I believe the author is attempting to convey to me that Ruby's suffering from all of the hate is never-ending. Since they despised her so much, she would have to stop and pray for them every day, according to the poem. They despised her because of her skin colour, according to the poem. Ruby was unable to alter the tone of her eyes. Ruby never missed a day of training. She never stopped hoping that anything like this would never happen to another girl. This is why the poem has no cycles. After the lines "Why, oh why can't I?" there are two question marks. I associate question marks with perplexity.

She is just six years old, according to the poem. She had to be perplexed as to why people were treating her so badly. The poem's point is that we do not treat anyone differently because they are different, and the question marks indicate how frightening this was for Ruby.

Explanation:

How does e.e. c connect the balloonman in his poem "in Just-" with the mythical figure of Pan?

He references other mythical creatures associated with Pan.

He describes how the balloonman attracts the children with sound.

He notes that the balloonman's home is on Mount Olympus.

He suggests that the balloonman is accompanied by several nymphs.

Answers

Answer: He describes how the balloonman attracts the children with sound. hope it helps

Explanation: cuz I said so

'in Just' is a poem by E. E. C. In the poem, balloon man is connected to the mythical figure of Pan as it describes how children are attracted by the sound.

What is the theme of the 'in Just'?

The poem 'in Just' is written by E. E. C. It portrays innocence, rebirth, spring, and some darker theme of corruption. The poet describes how the spring has arrived and introduces the lame balloon man.

The balloon man is described as 'goat-footed' as he compares and makes allusions to the Greek god Pan. Both the balloon man and Pan made sounds to attract the kids by whistling.

Therefore, option B. which describes how the balloon man attracts is the correct option.

Learn more about 'in Just' here:

https://brainly.com/question/902870

#SPJ2

Back to the future} could be suitable for a science fiction movie

- This statement is True or False?

Answers

Answer:

yes

Explanation:

because sxience is like fiction movie

7th grade English! Please help!
In a true/false question, every part of the statement must be true for the answer to be true.
A True

B False

Answers

Answer:

True

Explanation:

For every part of the statement every answer must be true for the answer to be true.

EX

let us say it's a Part A to Part B question for you to get full points you need to get both parts correct.

Answer: The answer is A: True

Explanation: The statement must be true Because if the statement is not true then it's a lie.

Smh I'm so not smart can anyone help me with this Please and Thank you <3​

Answers

Answer:

noun-dog

adverb-quickly

verb-ran

hope this helps

have a good day :)

Explanation:

Answer:

tourist, tourist, tearfully, turned

Explanation:

i literally just looked up words starting with t.

What words best characterize a teenage crush?
А
exciting and easy to handle
B
challenging and possibly awkward
impossible and dangerous
D) rewarding and pleasurable

Answers

Answer:

B

Explanation:

iM SURE ;)

The words that best characterize a teenage crush are B challenging and possibly awkward

What is a Crush?

This refers to the infatuation that a person has for a particular person that usually lasts for a short time.

Hence, we can see that in the case of a teenage crush, because they are both shy and possible socially awkward, then it most likely is to be challenging and possibly awkward

Read more about teenage crushes here:

https://brainly.com/question/15659475

Write a 120-word paragraph that includes an introduction about fast food and its advantages and disadvantages.

Answers

Explanation:

There are many reasons that many people love to eat fast food.  It is fast and easy to eat food which makes us satisfy.  But, recently, We have heard that fast food is farmful food for human.  However, recently, We hear that fast food is harmful food for human. There are too many researches about disadvantage of fast food.  I think that fast food has more hamful properties than benefit ones.

There are some reasons why fast food is harmful one.  First of all, Fast food is fried by oil.  For example, When it was fried, Chemical reactions occur.  By-products of these chemical reactions make us sick or give us bad effect.  Especially, Cholesterol is very harmful.  This material originally exist in our body as hormone.  But It is noxious in blood vessel and cardiovascular.  Secondly, Raw materials of this food don’t have good nutrition for body.  To be specific, People know that Ingredient of fast food is innutrious.  Children too much eat this food are considered obesity and lifestyle related disease.  These children go through growing season.  Therefore, Children too much eat this food are less tall and health than other children who eat nutritious food. 

On the other hand, There are advantage of eating fast food.  First, If we eat fast food by chance, To eat fast food is not harmful.  It is convenient to eat fast food.  We live in competitive society.  Time is gold.  Therefore, We occasionally eat this food for save time.  That is not bad.  Second, It is delicious to eat fast food.  Peopel like to eat delicious food.  We have right that we can eat food we love.  If we don’t eat  too much fast food, it is okey.

 To eat fast food has advantages and disadvantages for us.  But, I think that fast food has more disadvantages than advantages for these reasons.

Gisella is planning a speech advocating that all students be required to take two years of a foreign language prior to graduation. She is confident that most people in her class are against her position. Gisella feels that her strongest argument is the value of this skill when seeking employment, and decides to present this as her first main point. What principle is Gisella using

Answers

Answer:

Gisella is using the primacy principle.

Explanation:

As Gisella knows that the audience is against her position, she presents her main argument for students taking two years of a foreign language before graduating at the beginning of her speech so that the audience remembers the main point of taking these classes.

In other words, the primacy principle states that a person mostly remembers what the speaker says at the beginning of the speech, and the person will retain less information as time goes by. That is why Gisella must present her main argument at the beginning of the speech.

Why do businesses writer and speakers use propaganda gimmicks​

Answers

Answer:

Propaganda-is information, especially of a biased or misleading nature, used to promote or publicize a particular political cause or point of view. Explanation;

Levels of usage refers to the suggestive meanings of words.
True
False

Answers

Answer: False

Explanation:

Answer:

is true

Explanation:

of the text lies in the proper oral and, above all, written use of the language ... Morphological level: at this level, the form of words is analyzed based on ... exchanging meanings; and how it speaks to the realization of this social system that ... The notion of linguistic variety refers to the manifestations

Write a thesis statement that expresses the topic and your viewpoint on how the campaign effectively promotes the influenza vaccination to a range of audiences.

Answers

Answer:  The influenza vaccination to a range of audiences will be all about simply creating awareness that the disease can happen to anyone -- irrespective oftheir social or physical background. ... Hence it will focus on the contagious part of the disease.

Explanation:

The question wants to analyze your writing ability, for that reason, I can't answer the question for you, but I will show you how to answer it.

What is a thesis statement?It is the conclusion of the introduction of a text.It is a precise point in the text where the author's positioning is shown.It is the author's main opinion, based on facts and data.

To write your thesis statement, you need to read about the subject on which you will write the text and develop your opinion on the subject, based on the information presented by the texts you have read.

It is important to note that the thesis statement must be presented in two or three lines.

More information about the thesis statement at the link:

https://brainly.com/question/892903

PLZ HELP ILL GIVE BRAINLIST!

Answers

five

in an essay!

Explanation:

Answer:

4

Explanation:

That's how I would do it.

The accountant or his new intern want to see the documents.

Answers

I’m not sure what this means, could you give more information about the question or passage or whatever?

Which of the following terms describe Ben Price as a character? Select all that apply.

static
dynamic
antagonist
protagonist

Answers

Answer:

antagonist

is right answer

Answer: antagonist , static

Explanation:

Antagonist : If Batman was the superhero then joker was the villain.

Static : drama, lack of growth

The Flight of Icarus Compare and Contrast Paragraph.
write a paragraph about "The Flight of Icarus".

Answers

The story of Icarus is one of those legends of Greek mythology that fascinates audiences especially because of the character’s desire to go beyond human boundaries as well as for the tragic consequences this brought about.
The myth of Daedalus and Icarus tells the story of a father and a son who used wings to escape from the island of Crete. Icarus has become better-known as the flyer who fell from the sky when the wax that joined his wings was melted by the heat of the sun.
The legend of the mythological Icarus is closely related to a number of other narrations centered on Crete, the place where Dedalus worked as a craftsman and built a maze to keep the feared Minotaur under control.
The tragic fall of Icarus begins with his father, in fact, he suffered and paid for Daedalus deeds.

Reread lines 63–79. What evidence in the text suggests how Soto and his mother are feeling? What conclusion can you draw about the work they are doing?

Answers

Answer:

Lines 63-79 show that Soto and his mother are tired and discouraged, eating in silence and making grunts as they move. These are evidences that show that they are not happy with the work they are doing. They feel bored and are having a hard time.

Explanation:

This question is about "One Last Time" that tells the story of Gary Soto and how he survived an immigrant life with his family. The immigrant's life was full of difficulties and Soto had to work in the fields together with his mother to ensure the family's livelihood. On lines 63-79 we learned what it was like to work on the grape harvests, since Soto and his mother were extremely tired, sore, hungry and bored with the heavy work they were doing, but they knew it was necessary for their survival.

Can gossip and community storytelling be both good and bad? in Spunk
By Zora Neale Hurston
1926

Answers

Answer:

start with what you know

Explanation:

Why might a writer use summary?
A. To convey background information
B. To show events as they unfold
C. To trace actions in "real time"
D. To follow a character closely
SUE

Answers

Answer:

A or B

Explanation:

Answer:

The answer would be A. To convey background information

Explanation:

The reason why I would say that's it's A is because first of all, I'm personally doing a summary of a book at the moment and they've said that it's for background information without really telling exactly what happens in the story. Second, I've actually done research on this exact question and this is what I've found a few days ago: "You might use summary to provide background, set the stage, or illustrate supporting evidence, but keep it very brief: a few sentences should do the trick. Most of your paper should focus on your argument."

Hope this helps

Is the word methane technical talk why or why not? PLEASE HELP WILL MARK BRAINLIEST AND 20 POINTS

Answers

Answer: No, Methane is not technical because of it being a different subject of the word technical. Methane is to mean a chemical substance that is flammable, colorless and nontoxic gas with a chemical substance. Meanwhile Technical is related to a particular subject like art.

Explanation:

Other Questions
in 3/4 of an hour Ryan codes 3/5 of his game. at this rate how much of the game can he code in 1 hour The ratio that compares the measurements of a model and the real object is called what? help ASAP For brainlessly what is the complementary DNA of TACCGGATGCCAGATCAAATC? Which transition would best fit in the blank?We need to wash the dishes. ( ), we can go to the county fair.O A. AlthoughO B. After thatC. MeanwhileD. Similarly Relationship break up because of a number of reasons.Name and explain Two factors that contribute to a detrimental relationship? Solve for x given the picture I need an explanationWill mark brainliest Select the correct responses: Cules son los 3 usos de se mencionados en el video?Question 10 options:Los pronombres de doble objetoVerbos como gustarEl "se" impersonalLos pronombres demonstrativosEl "se" transitivoVerbos reflexivos y recprocos Please help me with 1,2,3,4,5,6,7,8,9,10,11 please I really need help explain how the genus and species name of an organism is properly written Explain what benefits you can achieve while performing either exercise? I needddd helppppp !!!whats the answer ? Which linear equation is written in slope-intercept form? Does the timing of a tsunami affect its impact? A 1.5m tall boy casts a 3m shadow. Calculate the height of a tree that simultaneously casts an 8m shadow. Please help choose oneA B C or D??? I have 3 Health questions about babies and pregnancies if any ladies can help me with these questions. Im failing this class and need to majorly bring my grade up. If there are any ladies that can help me with these's questions I'll give them Brainliest. ( Please only answer if you can actually help). I also have English questions to anyone can help with those questions. Im also failing English to. Just click on my name and go to my questions. Knives should be stored in cluttered drawers.True or false Consider the Tips for Responsible Financial Decisions discussed in this module. Using some of these tips, what advice would you give Brian on at least one of his financial decisions? How will your advice help Brian reach his financial goal? What is the volume of the square pyramid, in cubic inches?