13. Two Plants are growing in a greenhouse. A sunflower plant is 36 cm tall and
grows at a rate of 5 cm per week. An aloe plant is 96 cm tall and grows at a rate of 2 cm per week. After how many weeks will the plants be the same height?
Write and solve a system of equations that represents the given situation.

A. 25 weeks
B. 20 weeks
C. 15 weeks
D. 10 weeks

Answers

Answer 1

Answer:

B. 20 weeks

Step-by-step explanation:

I am using the graphing calculator my school uses for exams. But here is the step by step anyway

5x + 36 = 2x + 96

(5x - 2x) + 36 = (2x - 2x) + 96

3x + 36 = 96

3x  + (36 - 36) = (96 - 36)

3x = 60

(3x ÷ 3) = (60 ÷ 3)

x = 20

x represents weeks

Answer 2
The answer is B 20 weeks

Related Questions

Help me please thank you

Answers

Step-by-step explanation:

7-5=2(potato minus carrot side height)

5 ( carrot side length)

2×5=10

need help with this question, please

Answers

Given:

The expression is:

[tex]\left(\dfrac{6}{17}t-6\right)+\left(\dfrac{7}{17}t+9\right)[/tex]

To find:

The missing values in the simplification of the given expression.

Solution:

We have,

[tex]\left(\dfrac{6}{17}t-6\right)+\left(\dfrac{7}{17}t+9\right)[/tex]

Combining like terms, we get

[tex]\left(\dfrac{6}{17}t-6\right)+\left(\dfrac{7}{17}t+9\right)=\left(\dfrac{6}{17}t+\dfrac{7}{17}t\right)+\left(-6+9\right)[/tex]

[tex]\left(\dfrac{6}{17}t-6\right)+\left(\dfrac{7}{17}t+9\right)=\dfrac{13}{17}t+3[/tex]

Therefore, the missing values for 1,2,3,4 blanks are [tex]\dfrac{6}{17}t,9,\dfrac{13}{17},3[/tex] respectively.

Consider this rectangle.
The perimeter is P = 2(3) + 2(6) = 18 cm.
Suppose the dimensions of the rectangle are all multiplied by 4.
The new rectangle would have the dimensions _____
The perimeter of the new rectangle would be _ cm.
The new perimeter will be ___ times as large as the perimeter of the original rectangle .

Answers

Answer:

new dimentions = 12, 12, 24, 24

new perameter  = 72cm

new perameter will be 4 times as large as the original

Step-by-step explanation:

2(3*4) + 2(6*4) = 24+48 = 72

72/4 = 18

The new rectangle would have the dimensions 12 cm and 24 cm

The perimeter of the new rectangle would be 72 cm

And, The new perimeter will be 4 times as large as the perimeter of the original rectangle .

What is mean by Rectangle?

A rectangle is a two dimension figure with 4 sides, 4 corners and 4 right angles. The opposite sides of the rectangle are equal and parallel to each other.

Given that;

The perimeter of rectangle is,

⇒ P = 2(3) + 2(6) = 18 cm.

Now, After multiplied by 4 in all the dimensions we get;

Dimensions are,

⇒ 4 × 3 = 12

⇒ 4 × 6 = 24

Hence, The perimeter of the new rectangle would be;

⇒ 2 (12 + 24)

⇒ 2 × 36

⇒ 72 cm

⇒ 18 × 4 cm

Thus, The perimeter of the new rectangle would be 72 cm

And, The new perimeter will be 4 times as large as the perimeter of the original rectangle .

Learn more about the rectangle visit:

https://brainly.com/question/2607596

#SPJ7

Use the triangle formed by the vertices L(—3, 4), A(O, 5) and D(2, l). AL' A'D' is a triangle formed by using the transformation rule (x, y) —5 (—x, y) .

a. What type of transformation is ALAD —AL'A'D'?

b. Are A LAD and AL'A'D'congruent or similar?

A and B are not answers! They are parts to the question

Answers

answer: a
hope this helps out

A triangle has side lengths 7/8 and 3/4. What is the length of the third side, b?

Answers

Answer:

probably 2/4 try it I don't know

Answer:

1/2

Step-by-step explanation:

Mr. Stevenson is ordering shirts and hats for his Boy Scout Troop. There are 60 scouts in the troop. Hats come in packs of 3, and shirts come in packs of 5. What is the least number of packs each he should order so that each scout will have 1 hat and 1 shirt, and none will be left over?

Answers

Answer:
He should order 20 packs of hats and 12 packs of shirts.

Explanation:
60 ÷ 3 = 20
60 ÷ 5 = 12

I need help on this math assignment does anyone mind answering it?

Answers

The answer is 4. A function cannot have the same x value twice- 1 has two (2), 2 has all (1), 3 has two (-3), so 4 is the only answer.
The answer is 4 Hope that helps!!

Find the area of the circle when C = π/2 . Give your answer in terms of π.
NO LINKS !!!

Answers

Answer:

dfbbfbf

Step-by-step explanation:

dsktgsjfjvbgjshfhfthhvdh

What's the surface area rounded to the hundredth place

Answers

Answer:

Step-by-step explanation:

During each of the first three quarters of the school year, Melissa earned a grade point average of 21, 29. and 31
What does her 4th quarter grade point average need to be in order to raise her grade to a 3.0 cumulative grade
point average?
A 3.9
B. 4.2
C. 2.6
D. 3.5

Answers

Answer:

A. 3.9

Step-by-step explanation:

If Melissa scores a grade point average in the fourth quarter of 3.9, the the sum of all of her grade point averages would be 12, and that divided by 4 would make the average 3, giving her a grade point average of 3.

How would you best describe the two students outside the circles?
10 points and picture of question when u open

Answers

Answer:

A. They are boys who are not in sixth grade and don't wear glasses.

Explanation:

need this for work plz help me

Answers

5. 38.6 - 2.1 = 36.5. Michelle scuba dives 36.5 meters in 6.25 minutes. 36.5/6.25 = 5.84 meters. The average change in Michelle's position each minute is 5.84 meters.

6. 2/3 of 6 = 4. Bob would use 4 cups of sugar to make 2/3 of a batch of cookies.

It says it all on the added attachment.

Answers

to find the surface area of a figure, you find the area of each side and add it together
so the triangular shape would be
.5(6) * 8 = 24
.5(14) * 8 = 56
14 * 12 = 168
then you add 168 + 56 + 56 + 24 + 24 = 328
the surface area of the triangular shape is 328

the surface area of the rectangular prism
29 * 21 = 609
35 * 29 = 1015
21 * 35 = 735
735 + 735 + 1015 + 1015 + 609 + 609 = 3808
therefor the rectangular prism has a greatest surface area than the triangular shape because 3808 is greater than 328

4)who ever this right will get a brainlest

Answers

Answer:

D. $310.40

Step-by-step explanation:

We need to find 16% of 1,940:

1,940 x 0.16 = 310.4

$310.40

Answer:

310.40 dollars

Step-by-step explanation:

16% of 1940 is 310.4

we need to find 16% of the worth of dresses to find the commission because she makes 16% in commission.

Find the unknown side length for ABC.
A.) 483.86
B.) 171.36
C.) 13.09

Answers

It’s b I just had this
The correct answer is b

There are 5 sixth grade classes at Ditto Elementary. The number of students in each class is shown below.



22, 18, 24, 19, 22



What is the median number of students in these classes?

Answers

22 to find the median you must put all the numbers from least to greatest and then find the middle number and that is the median

Answer:

22

Step-by-step explanation:

Put them in order from least to greatest

18,19,22,22,24

Then cross one out from each side

19,22,22

Then cross one out from each side again

So you're left with 22

Hope this helps.

Brainliest would be appreciated

Find the interquartile range (IQR) of the data set.

Answers

Answer:

IQR = 157.5

Step-by-step explanation:

Q1 = 518.5

Q3 = 676

Equation = 676 - 518.5 = 157.5

Hope this helps!

it’s 157.5 i hope this helped :)))

HELP ME I GIVE BRAINLIEST

Answers

To find the mean you will have to add all the numbers and divide by how many numbers there are. In this case you would add:

10.09+10.14+10.29+10.07+9.99 = 50.58


So there 5 numbers if you count them...


Now you would divide 50.58 by 5 which gets you.....


10.116 which is the answer..


Have an awesome day and I hope this helped! <3



help me please :'-(((((((

Answers

Answer:

Step-by-step explanation:

10. mean, 15.5

    median, 16.5

    mode, 20

6. The population of India is close to 1.08*10^9. Which of the fallowing represents this population written in standard notation?

f. 1,080,000,000
g. 180,000,000
h. 1,080,000
j. 108,000

Answers

Answer:

... of India is close to 1.08 × 10^9 . Which of the following represents this population written in standard notation? ... 1,080,000,000. B. 1,080,000. C. 180,000,000. D. 108,000 ... We get the answer by multiplying and dividing the number by 109=1000000000 ... A 300−600−900 triangle has the smallest side equal to 10 cm.

Step-by-step explanation:

It’s f when using scientific notation if the exponent is positive that’s the amount of times you move the decimal point over to the right adding zeroes

i need answers quick 20 points

Answers

Answer:

Step-by-step explanation:

1) vertical

2) adjacent

Evan bought two plants. He decided to water his first plant every 3 days and his second plant every 4 days. If he watered both on June 1, when will Evan water both plants on the same day again?

Answers

Answer:

the 12th

Step-by-step explanation:

June 12th.

The first common multiple of both 3 and 4 is 12.

3,6,9,12... and
4,8,12...

What is the domain of the following relation?

Answers

C it is c don’t pick d

help plzzzzzzzzzzzzzz-

Answers

Answer:

Cant see it

Step-by-step explanation:

Select the statement that correctly describes the relationship between these two sequences: 1, 2, 3, 4, 5 and 10, 20, 30, 40, 50.

a

Each term in the second sequence is 10 times the corresponding term in the first sequence.

b

Each term in the second sequence is double the corresponding term in the first sequence.

c

Each term in the second sequence is 20 times the corresponding term in the first sequence.

d

Each term in the first sequence is double the corresponding term in the second sequence.

Answers

Answer:

a

Step-by-step explanation:

The answer would be A

Which is NOT a line of symmetry (please help)

Answers

Answer:

3

Step-by-step explanation:

The line 3 is not a line of symmetry.

What is Line of Symmetry?

Line of symmetry of a figure or a shape is the line which divides the figure or shape in to equal and symmetrical parts.

This line is also called as axis of symmetry.

It is sometimes also called as mirror line since the line divides in to parts which looks like mirror images.

Given is a shape of a triangle.

There are 4 lines drawn.

Of these, 3 lines are drawn from a vertex of the triangle to the middle point of the opposite side, which divides the triangle in to two equal triangles.

So these lines are lines of symmetry.

But line 3 does not divide the triangle in to equal parts.

So it is not line of symmetry.

Hence line 3 is not a line of symmetry.

Learn more about Lines of Symmetry here :

https://brainly.com/question/4032475

#SPJ2

Help as fast as possible help

Answers

Answer:

I think the answer might be 543.62

Step-by-step explanation:

I did the math and since yo just use the formula of a rectangular prism which is V=L*W*H it should give you 543.62, i hope it helps and I'm sorry if it didn't. Have a great day!

Please help with math again! ToT (10 points, link = report to moderators)

Answers

Answer:

10.D

Step-by-step explanation:

A=2(wl+hl+hw)

SA=(6,4*4)*2+(6,4*10,5)*2+(4*10,5)*2=269,6 square centimeters

I believe,this is it.

Since it is a juice box the dimensions fit to fold the box,so it's  easy to guess looking the parts that need to match together.(I wrote on the image the dimensions that were ''lacking''...)

what does the middle dot mean when doing math

Answers

Answer:

Im pretty sure you are talking about the multiplication sign.

The more you advance, the multiplication sign will look like that more often

It stands for the multiplication sign! Just a fancy way of writing it.

Need help. thanks. please answer within 45 minutes. I think i have selected the right ones but please confirm

Answers

Answer:

You have chose the correct ones.

Step-by-step explanation:

I know I'm late, but just wanted to help out!

Other Questions
I need help with this question on IXL Locations with extreme climates and few resources tend to have lower populations. True or False? Can someone pleaseeee help and if youre correct ill give brainliest Can someone please help me!?WILL MARK BRAINLIEST :) I NEED HELP ASAP!!!!!!! will give brainliest How does the content of the passage reflect the author's point of view?A. It shows that the author feels hopeless about the fate of our planet.B. It provides facts and statistics showing that the problem of water shortages is growing.C. It shows that the author dislikes the fact that cities are growing faster in the southwest than elsewhere.D. It shows that the author approves of ongoing scientific research. How was Benjamin Franklin similar to Enlightenment thinkers? The path of a rope bridge can be modeled by a quadratic equation h(l), where h is the height at a point on the bridge relative to the two ends of the bridge and l is the distance from one end of the bridge. One such bridge connects two ends that are 24 meters apart. The lowest point of the bridge is 3 meters lower than the two ends of the bridge Assuming the two ends of the bridge are at an equal height of h = 0 meters, which of the following graphs could be the graph of h (l)? why do some scientists believe that humans evolved from apes?a: because fossil records show homologous structures indicating a common ancestor b: because humans and apes lived around the same time period After sitting out of a refrigerator for a while, a turkey at room temperature (69F) isplaced into an oven. The oven temperature is 300F. Newton's Law of Heatingexplains that the temperature of the turkey will increase proportionally to thedifference between the temperature of the turkey and the temperature of the oven, asgiven by the formula below:T = Ta + (T. T.)e-ktTg = the temperature surrounding the objectTo = the initial temperature of the objectt= the time in hoursT = the temperature of the object after t hoursk = decay constantThe turkey reaches the temperature of 127F after 3 hours. Using this information,find the value of k, to the nearest thousandth. Use the resulting equation todetermine the Fahrenheit temperature of the turkey, to the nearest degree, after 5hours.Enter only the final temperature into the input box. Based on what you read about the Compromise of 1850, what would you say was the worst part about it for the future of the United States and why? in 3/4 of an hour Ryan codes 3/5 of his game. at this rate how much of the game can he code in 1 hour The ratio that compares the measurements of a model and the real object is called what? help ASAP For brainlessly what is the complementary DNA of TACCGGATGCCAGATCAAATC? Which transition would best fit in the blank?We need to wash the dishes. ( ), we can go to the county fair.O A. AlthoughO B. After thatC. MeanwhileD. Similarly Relationship break up because of a number of reasons.Name and explain Two factors that contribute to a detrimental relationship? Solve for x given the picture I need an explanationWill mark brainliest Select the correct responses: Cules son los 3 usos de se mencionados en el video?Question 10 options:Los pronombres de doble objetoVerbos como gustarEl "se" impersonalLos pronombres demonstrativosEl "se" transitivoVerbos reflexivos y recprocos Please help me with 1,2,3,4,5,6,7,8,9,10,11 please I really need help explain how the genus and species name of an organism is properly written