Which is a correct statement regarding settling disputes peacefully?

One should ask an adult or friend to solve the dispute.
Not everyone’s opinion or idea is valid in a dispute.
Some disputes are just not very important.
Disputes should be solved without outside help.


do you know this question lol

Answers

Answer 1

Answer:

Disputes should be solved without outside help.

Answer 2

Answer: D

Explanation:

I did the Unit Test Review edge 2021


Related Questions

How would dry climates affect a population's density

Answers

Answer:

Increases in global temperatures have created concern about effects of climatic variability on populations, and climate has been shown to affect population dynamics in an increasing number of species.

Explanation:

Which year did the gold rush start?

Answers

Answer:

The California Gold Rush started in 1848

The Gold Rush started in 1848.

Due to the______of oil in the world, Middle Eastern countries have developed oil as their main trading commodity and gained a lot of political power.

A:mass production
B:scarcity
C:reserves
D:high price ​

Answers

Answer:

its A

Explanation:

Its fairly axiomatic that middle eastern countrys mass produce oil

Answer:

The answer is A :)

help me please and thank you

Answers

Answer:

the formula D is not correct

What would be the most appropriate title for this timeline 1836

Answers

Answer:

Texas Fight for Independence

Which statement most accurately summarizes research on family violence? A. Family violence primarily occurs in lower socioeconomic families. B. Family violence occurs at all socioeconomic levels, races, and ethnic groups. C. Family violence is more prevalent in families with young children. D. Family violence frequently results in the death of one or more family members.

Answers

Answer:

B. Family violence occurs at all socioeconomic levels, races, and ethnic groups.

Explanation:

Family violence can be defined as the use of force or threat, either physically or emotionally against a family member.

The statement that most accurately summarizes research on family violence is that family violence occurs at all socioeconomic levels, races, and ethnic groups.

Plant roots are not green, why? Also what do the roots of a plant provide for the plant?

Answers

Answer:

Because the roots are underground and they don't receive light, so there is no need for them to have chlorophyll. And that's why they are white and leaves are green. also, The roots anchor the plant in place, resisting the forces of wind and running water or mud flow.

A biological catalyst is called an?

Answers

Answer:

Biological catalysts are called Enzymes

Explanation:

Now that the colonists have won the war, who should make the discussion as to what the new government looks like?

Answers

Answer:

whether the colonists should have revolted against Great Britain. Topic Background At the time of the Revolutionary War, public opinion varied about whether the colonists should revolt against Great Britain. Those who encouraged revolt were called Patriots. Some wanted to remain loyal to Great Britain and were called Loyalists.

Explanation:

How does a decrease in abiotic resources impact the population growth in an ecosystem

Answers

Answer:

Explanation:

Eventually, there will not be enough resources for each individual and stress will occur. Some individuals may become weak and diseased and/or the increased population size may result in more predators moving into an area. Humans can interfere with the carrying capacity of an organism.Abiotic factors are non-living physical and chemical elements in the ... Biotic factors are living or once-living organisms in the ecosystem, ... Density-dependent limiting factors make the per capita growth rate decrease as the population ... about human population growth and its effects on the environment

list three factors which promote the growth of microorganisms​

Answers

Answer:

I will give you 6.

Explanation:

1. Solutes and Water Acidity

2. Temperature

3. pH

4. Oxygen Requirements

5. Pressure

6. Radiation

Hope this helps.

Both the moon and the sun influence the tides on earth. The moon has a much greater influence though. why is that?

Answers

Answer:

Based on its mass, the sun's gravitational attraction to the Earth is more than 177 times greater than that of the moon to the Earth.Therefore, the sun's tide generating force is about half that of the moon, and the moon is the dominant force affecting the Earth's tides.

Explanation:



Why would a nation most likely use military force? Check all that apply.

Answers

A nation would most likely use military force to either portray power or for provoked reasons. You didn’t give the answer choices so I’m not sure how to help you.

What is the biggest event that caused the US to enter WW||?

Answers

Answer:

Submarine warfare in the Atlantic kept tensions high, and Germany’s sinking of the British ocean liner Lusitania on May 7, 1915, killed more than 120 U.S. citizens and provoked outrage in the U.S. In 1917, Germany’s attacks on American ships and its attempts to meddle in U.S.-Mexican relations drew the U.S. into the war on the side of the Allies. The United States declared war on Germany on April 6, 1917.

Explanation:

The competition for lands abroad, especially in _______, led to conflict and heightened the existing rivalries among European states. A. Asia B. Africa C. South Americat D. North America

Answers

Answer:

Africa

Explanation:

hope it helps :)

Answer:

D. North America

Explanation:

European countries fought over the North Americas for many reasons:

Passage way to asia (isnt possible), gold, and many other things.

Helppp fast

Should students be required to stay in school until they are 18.

Essay

Answers

yes they should & why because many people still get out of school at the age of 17-18 or finish school and just attending another one

When Mexico won its independence from Spain in 1821, it tried to keep American traders out of New Mexico. true or false​

Answers

Answer:

True

I think, if it's wrong, I'm sorry!

The answer is false.

Do you think Gandhi would have considered the protest methods to use body-force or soul-force? Explain.

Answers

Answer:

I think Gandhi used the soul-force because indeed pictures they both show sacrifices of self. The picture of Gandhi and the spinning wheel shows Gandhi reading a book wearing little clothing, and his all skin and bone. He was showing sacrifices of self which indicates soul-force.

Explanation:

Explain the functions of the North American Free trade agreement​

Answers

The agreement is between the United States, Canada and Mexico, and was initially created to help lower costs of trade and bolster North American trade. The agreement eliminated almost all tariffs and taxes on imports and exports. The agreement also rid the three countries of trade barriers.

Hope you like my answer.

You can follow me to get more answer.

Answer:

The function of the North American Free trade agreement was to promote trade between the U.S., Canada, and Mexico.


Help me with this one please

Answers

Answer:

the answer to the question is C.

The correct answer is d

In your opinion, which component of government spending is the most important?

Answers

I think that Medicaid is the most important component of government spending because Medicaid provides often life-saving, health care, and community support to millions of children and adults living with disabilities

what are the male reproductive parts of a flower ?

Answers

Answer:

stamen ( a male flower part)

Explanation:

The stamen is the male reproductive organ. It consists of a pollen sac (anther) and a long supporting filament.

Hope this helped!!

Here is a joke to brighten your day!

A woman gets onto a bus with her baby.

The bus driver says, “That’s the ugliest baby that I’ve ever seen. Ugh!”

The woman goes to the rear of the bus and sits down, fuming. She says to a man next to her, “The driver just insulted me!”

The man says, “There’s no call for that. You go right up there and tell him off. Go ahead, I’ll hold your monkey for you.”

1. Why did people call General Scott's plan of attack The Anaconda Plan?

Answers

Explanation:

Began with a powerful move down the Mississippi River to dominate it and eventually split the Confederacy into two parts. It was called the Anaconda to resemble how the Union planned to choke the Confederacy, just like and Anaconda chokes it's prey

is the sentence true or false "legend states that Yu helped build channels that improved travel to and from china."

Answers

Green infrastructure increases exposure to the natural environment, reduces exposure to harmful substances and conditions, provides opportunity for recreation and physical activity, improves safety, promotes community identity and a sense of well-being, and provides economic benefits at both the community and household ...

80 POINTS! THE WIZARD OF OZ STORY!
What is the central idea of Passage 1, paragraph 5?
A. The Munchkins had round and pointed hats.
B. The sparkling little old woman.
C. The clothes of the little Munchkins.
D. The appearance of the odd people.

Answers

D. The appearance of the odd people

The wizard of the story from passages one to five is the appearance of the odd people. Thus option D is correct.

What s a wizard?

A wizard is a magician who is known to enchanter the magic verses and can cast a spell. They are one who practices magic that is derived from the supernatural cult. As per the page the appearance of the old people are due to magicians' activities.

Find out more information about the wizard.

brainly.com/question/5305223

What was the Federalists’ view of the Constitution?

1.They would approve of the Constitution only if Anti-Federalists favored it.
2.They did not favor the Constitution.
3.They would only favor the Constitution if major changes were made to it.
4.They approved of the Constitution.

Please help quick!!

Answers

Answer:

#4

Explanation:

Have a nice day!

Answer: the approved of the constitution

Explanation:

Did test

What part of the 5 pillars do you think would be the most difficult challenge?

Answers

Answer:

5 pillars of islam I assume

Explanation:

Fasting would most likely be the most challenging as fasting is difficult enough for one day imagine not eating a whole month.

Read the excerpt from a student’s essay. Coastal towns should protect themselves from floods by building sand walls that keep out water from oceans, lakes, and rivers. However, some say that these sand walls are an eyesore. They reduce the value of the homes and buildings that they try to protect because they look bad. Which statement presents the best rebuttal to address the counterclaim? The value of the coastal homes is more important than oceans, lakes, and rivers. The protection of homes and buildings in coastal towns with sand walls is important. Sand walls may be ugly, but the protection of people and property is more important. People living along the coasts should seriously consider moving further inland.

Answers

The answer is c the part that says sand walls

Answer:

C

Explanation:

Sand walls may be ugly, but the protection of people and property is more important.

I got is a 100 on a quiz. hope it help

Look at the map of Europe. A map of western Europe. The following countries are labeled: Kingdom of Scotland, Kingdom of England (which includes western half of modern France), Kingdom of France, Kingdom of Navarre, Holy Roman Empire, Kingdom of Denmark. Which of the following would be the best title for the map? The Roman Empire Europe after the Norman Conquest The Holy Roman Empire The First Crusade

Answers

Answer:

Wales Scotland Ireland England ... in the proper order, representing how most areas of Western Europe grew over time: nucleated town, linear hamlet, t-shaped village. ... According to the map below, which area of the map represents clustered settlement?

Explanation:

Which territory did the Normans conquer in 1066?

✔ Anglo-Saxon Kingdom

This event led to the creation of

✔ England

.

Which territory did the Muslims take over after the decline of the Roman Empire?

✔ Caliphate of Cordoya

Most of this region later became part of

✔ Spain

.

-EDGE 2021

When was the era of the Texas Republic?
A: March 2, 1836 - 1865

B: March 2, 1836 - 1850

C: March 2, 1836 - 1840

D: March 2, 1836 - 1845

Answers

Answer:

D

Explanation:

The Texas republic was from 1836-1845

Other Questions
where did Jewish immigrants to South africa come from what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? Did I do this right? if I didn't get it right can you help me? Thank you! Determine which number is a solution to the inequality. These four numbers are plotted on a number line:-23,58,-35,-12Which is the correct ordering on the number line, from left to right? A . -12,-35,-23,58 B. -12,-35,58,-23 C. -23,-35,-12,58 D. -35,-23,-12,58 Mahi has 31 rolls of string. Each roll holds 12 yards of string. How many feet of string does she have? can anyone tell me my mistakes pls? Help me pleas I need help to solv this problem please help worth 20 points Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Please help I need this done!Will give the brainliest! how many cm are in 84.363 km Why was Winston Churchill opposed to Neville chamberlain signing the Munich pact ? Many Americans are continuing to work well into their 60s and beyond. About 20% of America's workforce is made up of people who are 55 years old or older. Instead of not working during their golden years, people are choosing to stay employed. Some still work because they want to remain active and productive. Others still work because they need the income. Whatever the reason, many government agencies predict that the number of older people in the workforce will continue to grow.Based on the passage, what does the euphemism golden years mean? A. generation B. old age C. existence D. early life It take 38.70cm of 1.90 NaO4 to neutralize 10.30cm of H2So4 in a battery. Calculate the molar concentration of H2So4 What are the dimensions of this matrix?7 8 6 3 You are on a road trip and have driven 24 miles, which is 3/4 of the total distance.What is the total distance of this trip? The diameter of a cake is 7.8 inches. What is the area of the cake? Favorite Colorred32.86 %blue24.36 %yellow15 %green27.78 %1728 students were asked to name their favorite color.The results are shown in this circle graph.How many students gave green as their favorite?O A 94OB. 480O c. 28D. 432O E. 568 Water in the blood helps carry nutrients and gases required foe survival througout the body. Which characteristics of water allow for this action?A.water has a neutral pHB.water maintains temperatureC.what expands when it freezesD.water dissolves many compounds