what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer 1

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons


Related Questions

what can a negative consequence of humans being hunter-gatherers?

A. they needed to stay in one location for food

B. Nate cultivated their own food

C. they had to move around to find food

D. they had to have large families to help on the farm​

Answers

Answer:

C

Explanation:

The use of fossil fuels is a concern because it can lead to which of the following?
O increased runoff
O global warming
O polluted waters
Oeutrophication

Answers

Answer:

O global warming

Explanation:

The use of fossil fuels is a concern because it can lead to global warming.

Which of the following are parts of a bacterial cell?

Select all that apply.

mitochondria
flagella
cell wall
pili

Answers

Answer:

It is a gel-like matrix composed of water, enzymes, nutrients, wastes, and gases and contains cell structures such as ribosomes, a chromosome, and plasmids. The cell envelope encases the cytoplasm and all its components. Unlike the eukaryotic (true) cells, bacteria do not have a membrane enclosed nucleus.

Explanation:

Flagella, cell wall, and pili are parts of a bacterial cell.

What is a bacterial cell?

Microscopically small, single-celled creatures known as bacteria are found in millions in every habitat, both within and outside of other living things.

Some bacteria are hazardous, but most serve a helpful role. They are employed in industrial and medical procedures and sustain a wide variety of living forms, including both plant and animal life.

Around 4 billion years ago, bacteria are assumed to be the initial lifeforms to emerge on the planet. The earliest fossilized creatures are bacteria-like ones. Most biological and some materials can be used as food by bacteria, and certain strains can withstand harsh environments.

New insights into the functions of the gut microbiome are being provided by this expanding interest in how microorganisms affect human health. Bacteria are prokaryotes that do not contain any membrane-bound organelles.

Therefore, flagella, cell wall, and pili are parts of the bacterial cell.

Read more about the bacterial cells, here

https://brainly.com/question/21141798

#SPJ2

What is the main function of leaves?A. Leaves provide support for growth and a place to store food.B. Leaves provide a place for photosynthesis to occur.C. Leaves absorb water and minerals and transport nutrients to the stem.D. Leaves create a barrier that prevents water in the plant's tissues from evaporating

Answers

Answer:

B

Explanation:

The main function of a leaf is to produce food for the plant by photosynthesis.

Answer:  The correct answer is B. Leaves provide a place for photosynthesis to occur.

Explanation:  Confirmed correct.

islfso lufe
(Hint: a non-renewable resource, like coal)
CHAPTER
1 what is the term?

Answers

Answer:

Fossil fuel

Explanation:

_______ Which nutrients should we limit and eat less to promote good health?
a. protein, sugars and total fat
b. sugars, fiber and total fat
c. total fat, cholesterol and sodium

Answers

c. total fat, cholesterol and sodium

I think the correct answer is B or C

Worth 26 points! Help me please! Do 1,2,3 by filling in the blank!!!! And I will make you brainest!
And don’t answer just to get points or I am reporting you

and no website

Answers

Answer:

Glucose is the word!!

Which of the following best describes natural selection?

A. organisms vary in their physical traits, and some are inherited

B. Organisms compete for food and shelter

C. organisms best suited to their environments are most likely to survive and reproduce

D. Organisms produce more offspring than can survive

Answers

Answer: C

Explanation: according to Darwin, out of the vast no of individuals which compete for a place in the world, only those having advantageous variations survive and reproduce
C remember the key word is natural

deposits of coal have been found beneath the ice of Antarctica. But coal only forms from warm swamps. How can coal be found so near the South Pole?

Answers

Deposits of coal have been found beneath the ice of Antarctica. But coal only forms in warm swamps. ... According to Wegener's hypothesis, coal could be found near the South Pole because during the time of Pangaea, the South pole was near the equator causing it to be warm and allowing coal to form.



Hope it helps

Which of the following resources are used the most in the US.

Coal
Natural Gas
Oil
Nuclear Energy
Solar
Wind
Hydropower
Geothermal
Biomass/biofuel

Answers

Oil, coal and natural gas my guy

Hope that helps

Why does the ability to lay 1,000 to 5,000 eggs increase the fitness of the species L. clamitans clamitans?


It increases the probability that moving water will promote gene flow from one population to another.

It increases the chance of the recombination of alleles, leading to genetic drift in the population.

It increases opportunities for offspring to compete for limited resources.

It increases the probability that some offspring will survive long enough to reproduce.

Answers

Answer:

increases opportunities for offspring to compete for limited resources.

How much water on Earth is salt water?

Answers

Answer:

97 percent

Explanation:

Science

Answer:

below

Explanation:

Over 97 percent of the earth's water is found in the oceans as salt water. Two percent of the earth's water is stored as fresh water in glaciers, ice caps, and snowy mountain ranges. That leaves only one percent of the earth's water available to us for our daily water supply needs.

FOR 100 POINTS AND I WILL MARK BRAINLIEST!!!!!

Horses have three basic coat colors: red (or chestnut), bay, and black. All the colors are controlled by the interaction of two genes, Extension (E) and Agouti (A). The following combinations produce bay color: EE/Aa, Ee/Aa, EE/AA, Ee/AA. Only two produce black color: EE/aa, Ea/aa. Other combinations of the alleles of these genes plus mutations of others result in many possible coat colors and patterns in horses

Coat color in horses is an example of which type of inheritance?

(1 point)

A. polygenic inheritance

B. dominant inheritance

C. Mendelian inheritance

D. recessive inheritance

Answers

Answer:

A. Polygenic inheritance

Explanation:

When the qualities or the attributes are passed from the parent to their progeny is called inheritance. It can be passed either sexually or asexually.

The correct answer is:

Option A. Polygenic inheritance

This can be explained as:

When a trait is regulated by two or more genes is called polygenic inheritance.

Dominant inheritance occurs when the qualities from the parent possessing the dominant gene pass to the progeny.

According to Mendelian inheritance paired genes assorts independently and are passed from parent to their progenies.

Therefore, coat colour in horses is an example of polygenic inheritance.

To learn more about polygenic inheritance follow the link:

https://brainly.com/question/22923

3. What is a type of asexual reproduction that com-
monly occurs in many species of unicellular pro-
tists? (1) external fertilization (2) tissue regenera-
tion (3) binary fission (4) vegetative propagation

Answers

Answer:

In fission (or binary fission), a parent separates into two or more individuals of about equal size. This type of reproduction is common among single-celled organisms including bacteria, archaea, and unicellular eukaryotes, such as protists and some fungi. The single cell divides into two daughter cells.Aug 17, 2016

Explanation:

the answer is binary fission


What does "reliably" mean in these sentences?

Answers

Answer:

it would be the top right one

Answer:

in a way that can be trusted

Explanation:

hope this helps!

(no reporting nor deleting this.)

Which of the following are characteristics of
Zygomycota? Check all that apply.
D
lack reproduction phase
spores produced in basidia
spores produced in zygosporangia
important in the food industry
important in the fermentation process
can cause disease to plants
can cause disease to animals

Answers

Answer: 3- spores produced in zygosporangia

5- important in the fermentation process

Explanation:

Answer:

in the picture

Explanation:

what did humans evolve from I am creating a a evolution chain I know this can be considered a unintelligent question I am just not positive on what we evolved from

Answers

Answer: Human evolution, the process by which human beings developed on Earth from now-extinct primates. Viewed biologically, we humans are Hono Sapines, a culture-bearing upright-walking species that lives on the ground and very likely first evolved in Africa about 315,000 years ago.

Human evolution is not linear manner it is a web, in the process of evolution primates lead to the emergence of homo-sapiens, which is distinct from the hominid family.

How did humans evolve?

Human evolution is observed in a web manner not linear in evolutionary history primates lead to the homo-sapiens which is distinct from another family of hominids.

The hominid family includes great apes that diverged from the gibbons 15-20 million years ago. Evolution involves some studies, genetic studies, and h behavioral studies.

Anatomically it is observed in Africa 300000 years ago humans appeared, these studies were observed anatomically as the origin of humans.

Therefore human evolution is observed in a web manner not linear.

Learn more about human evolution, here:  

https://brainly.com/question/24276894

#SPJ2

Please help!!

Explain why it would be financially beneficial for a farmer to treat a fruit crop with gibberellins.

Answers

Answer:

Gibberellins can promote flowering, which can result in more financially profitable flowers to sell due to the increased speed of flower growth. More attractive flowers and larger specimens are also produced. Flowering also has an impact on the rate of fruit growth.

Explanation:

Which is not a reason for biodiversity in an ecosystem.

A. Organisms can adjust to environmental changes

B. The ecosystem provides a variety of food for organisms

C. Water scarcity

Answers

Answer:

C

Explanation:

it's water scarcity because biodiversity is variation among a group of populations. water scarcity would kill out animals and diminish biodiversity in an area

Answer:

C. Water scarcity

Explanation:

Hope you have a great day :)

HELP PLEASE I WILL GIVE BRAINLIEST

Answers

Explanation:

A is the correct answer in my opinion. Thanks.

I think A as well :)

The Rio Grande River separates Mexico from Texas.

What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion

Answers

Answer:

d I think or b?

Explanation:

water could cause it to form a river and spread over time

An organ that makes and secretes hormones is called a
1] lung
2]gland
3]pancreas
4]thyroid

Answers

Answer: 2]gland brainliest?

Explanation:

Marcus grew three rosemary plants. He put one in
direct sunlight, one in the shade, and one in the
dark. The plant in the sun grew the most quickly
and looked the healthiest. Marcus concluded that
rosemary plants grow best in the sun.
How would you evaluate Marcus's conclusion?
O A. His conclusion is valid because his
experiment included a control.
B. His conclusion is valid because he tested
only one variable.
O C. His conclusion is flawed because he did
not perform enough trials.
O D. His conclusion is flawed because it is
based on the appearance of the plants.

Answers

Answer:

His conclusion is flawed because he did

not perform enough trials.

Explanation:

i jus took the test

1Which of the following animals is a primary consumer?

Answers

cant see the following animals

which statement best describes an example of selective breeding?​

Answers

Answer: the answer is A

Explanation:

genes for traits that help an organism be more successful reproductively can be expected to ...

A - cause it to evolve into species

B - eventually be eliminated by natural selection

C - become more common in the future

D- cause the extinction of the species

Answers

C - become more common in the future

HELP right now please! No websites

Answers

Carbon dioxide is the name of the molecule I believe
CO2. Carbon Monoxide

A student claims that the only difference between prokaryotic cells and eukaryotic cells is that
eukaryotic cells have a nucleus, but prokaryotic cells do not. What is wrong with this claim?

The description of the cell types is incorrect.

Prokaryotic cells have a nucleus, and eukaryotic cells do not.

The description of the cell types is incorrect. Both prokaryotic and eukaryotic cells have a nucleus.

There is another difference between the cell types. Eukaryotic cells have membrane-bound organelles, but
prokaryotic cells do not.

There is another difference between the cell types. Eukaryotic cells have a cell membrane, but prokaryotic
cells have a cell wall instead.

Answers

Explanation:

Eukaryotic cells:

• There is a well defined nucleus

• They are membrane bounded cell organelles like chloroplast, golgi bodies, mitochondria.

Prokaryotic cells:

• The nucleus are not well defined

• Cell organelles are not bounded by membrane

Chlorophyll is essential to photosynthesis because it traps the _______________ needed. A. oxygen B. carbon dioxide C. sunlight D. water

Answers

Answer:

sunlight

Explanation:

cawg

Answer:

C. sunlight

Have a good day

Causes of gonorrhea
Please list 3 causes

Answers

Gonorrhoea is a sexually transmitted infection (STI) caused by bacteria called Neisseria gonorrhoeae or gonococcus. It used to be known as "the clap
Four causes of gonorrhea are;
Vagina
Throat
anus.
female reproductive tract (the fallopian tubes, cervix, and uterus)
sexual contact, including oral, or vaginal intercourse
Other Questions
In which phase of website design does the designer create a mock-up aimed at the target user? A. learning B. planning C. design D. development E. testing and delivering 31 The table gives the content of glucose, urea andcalcium ions in the blood entering the kidney, inthe glomerular filtrate and in the urine of a person.Values are given in mg per 100 cm'.Component/mg per 100 cmBlood Glomerular filtrateUrineComponentglucose100100urea26261820Scalcium ions445Ca):) Which of the components provides energy forthe body?ii) Which of the components is a metabolicwaste product?[1]b) Explain why the figures for each component are thesame for the blood concentration andglomerular filtrale.[3]c) i) If thepersondrank a large volume of water,far more than was needed by the body,predict what would happen to the figuresin the urine column.[2]ii) Describe the processes taking place in thebody to support your answer to (c)(i). [3]3 Beetles in a certain population can either be green color or brown colored. A change in the environment has caused the green colored beetles to become more visible and heavily prayed upon by other animals. Because of this change in the environment, what will most likely happen to this beetle population.?A. The number of brown colored beetles will increaseB. The green colored beetles reproduce at a faster rateC. The green colored beetles will change their color to brownD. The population of green colored and brown colored beetles will become extinct Will give Brainliest!2x2(69.4 x 2) please help please please please . If the value of a is negative in the quadratic function, f(x) = ax + bx + C, and the vertex is at (13, -2), then how many x-intercepts will the graph have? A. can't be determined. 0 C. 1D. 2 Find the domain of the relation:{(-3, -4), (-1, 2), (0, 0), (1, 3), (5, 4);0 (-3,-1, 0, 1,5)O {-4, 0, 2, 3, 43{-4, 2, 3, 43O {-4, -3, -1, 0, 1, 2, 3, 4, 5} PLZZ HELP I'LL GIVE EXTRA POINTSrough draft:explaining the different kinds of sacrifices people make in a relationship, the value in making sacrifices, and how to determine when to make a sacrifice? Find the measure of angle H what is the opposite meaning of taunt how do you rewrite 4 5/7 as an improper fraction. in stepsplease don't use files they don't work Writealgorithm to read 100 numbersthen display the largest. Pls help! Will mark brainliest!! Mary wants to make bouquets of roses. She has 32 lavender roses, 48 pink roses and 64 white roses. She wants each bouquet to have the same number of flowers of each color. What is the maximum number of bouquets she can make? Choose only ONE best answer. 8 B 16 C 24 D 32 E 192 What is r?r = one-thirdr = 3r = two-thirdsr = one-half For a thunderstorm to occur there must be instability lift and _______? A. Moisture. B. Cold temperatures. C. A time between noon and 3:00 Convert: 11,000 feet = miles and feet De repente, los empleadosa. salandel trabajo a las 2 de la tarde.b. salieronPlease select the best answer from the choices provided The Desert is found in thesouthern portion of Africa.O GobiO KalahariO NamibO SaharaPLS HELP ASAP will give brainliest..Number the following sentences about the settling of the colonies and the forming of the United States so that they are in the correct order.did i order them correctly???