What was Lincoln’s position on slavery and its spread?

Answers

Answer 1

Answer:

Lincoln was morally opposed to slavery and politically opposed to any expansion of it. At issue was an extension into the western territories. On October 16, 1854, in his "Peoria Speech", Lincoln declared his opposition to slavery, which he repeated in his route to the presidency.

Explanation:

Answer 2
He was opposed to slavery

Related Questions

How does denying women the right to vote alter the concept of "consent of the governed"?​

Answers

Answer:

"Consent of the govenered" implies that all that are governed (Citizens) have the right to consent (Vote). To deny women the right to vote is denying a citizen, who is being governed, the right to consent to what the government does.

HELP PLZ


The map shows the expansion of the Roman Republic.
(BELOW)

According to the map, which territory did Rome gain during the Punic Wars?

Asia Minor
Gaul
Rome
Spain

Answers

According to the map, Spain territory did Rome gain during the Punic Wars. Thus, option (d) is correct.

What is map?

A “map” refers to a visual representation of a particular place, such as a city, town, hamlet, or part of the planet. Locate a location fast by using a map. The map represents four directions such as North, East, West, and South. The map is shown on a particular location and makes use of figurative lines for things like food, traffic, and roads.

As a result of the Second Punic War all Carthaginian holdings in Spain came under Roman control. Rome expanded tremendously as a result of its status as a location with a thriving export economy and a richness of natural resources, owing to the gains of Spain and the Iberian Peninsula. Sicily was annexed by Rome, followed by Sardinia and Corsica.

As a result, the map, Spain territory did Rome gain during the Punic Wars. Therefore, option (d) is correct.

Learn more about it on the map, here:

https://brainly.com/question/1565784

#SPJ2

answer: d - [spain]

explanation: after winning all 3 punic wars, rome got all of spain territory. also, i'm taking the cumulative exam rn.

hope thiis helps, good luck ! <3

1. TRUE or FALSE: Tensions between Israeli's and Palestinians still exist today?
A.True
B.False

Answers

Answer:

tRUE

Explanation:

Im Palestine and my parents tells me about this almost everyday :|

(No links)Pls help me~ history~I’ll mark brainliest if correct

Answers

Answer:

Im go with C but I could be wrong

Explanation:

Who was Lucretia Mott and what was her significance?

Answers

Answer:

Lucretia was a feminist activist, abolitionist, social reformer and pacifist who helped launch the women's rights movement.

Answer:

Hey mate....

Explanation:

This is ur answer.....

Lucretia Coffin Mott was an early feminist activist and strong advocate for ending slavery. A powerful orator, she dedicated her life to speaking out against racial and gender injustice. Lucretia Mott was a 19th-century feminist activist, abolitionist, social reformer and pacifist who helped launch the women's rights movement

Hope it helps!

Brainliest plz.....

Follow me! ;)

What method did farmers use to grow crops in the challenging West Texas climate?​

Answers

Native Americans were the first to grow crops on West Texas soil, and were soon followed by pioneers who saw the area as a land of opportunity. Everything from corn, cantaloupe, and cotton were tried with success as farmers resiliently adapted to their environment.

By the start of the 20th century, cotton became the foundation of the area’s agricultural economy and boomed in the 1920s. Cattle ranching and poultry production were also important factors, and sorghum production soon followed.

Corn became even more important as cattle ranching expanded in the area. Corn became a major livestock feed crop, although its production began to decline after World War II. During this time farmers began to rely less on animal power, and more on machinery to work their crops.

The area also has a long history of petroleum extraction, and entire towns grew up around economic possibilities. Railroad lines were developed to connect the region with other areas of the state and the U.S.

People who take an Oath of Allegiance to the United States must renounce, or give up,
allegiance to all other countries. Why do you think this is so?

Answers

Answer:It signifies the end of the immigrant experience and is the final threshold before one's acceptance as a citizen. ... The oath requires the intending citizen to “absolutely and entirely renounce and abjure all allegiance” to any country that he or she has been a citizen

Explanation:"I hereby declare, on oath, that I absolutely and entirely renounce and abjure all allegiance and fidelity to any foreign prince, potentate, state, or sovereignty, of whom or which I have heretofore been a subject or citizen; that I will support and defend the Constitution and laws of the United States of America"

How did rivers help shape Chinese civilization?

Answers

They provided them with fresh water

What is significant about the 9/11 attack in terms of terrorism?
NO RANDOM WEBSITES, ONLY GENUINE ANSWERS OR THE ANSWER WILL GET REPORTED IF ITS A WEBSITE

Answers

Answer:

It is the deadliest terrorist attack in human history and the single deadliest incident for firefighters and law enforcement officers in the history of the United States, with 340 and 72 killed, respectively.

Explanation:

Can this cartoon be used in any way to argue that alliances were a cause of WWI?

Answers

Answer:

yes it can

Explanation:

the alliances is what started the war

Yes the alliances among the countries was one of the cause of the WW1. The alliances provided European states with a measure of protection. They served as a measure of guarding or advancing national interests while acting as a deterrent to war.

What was World War 1?

World War 1 or the Great War was an international conflict in 1914-18 embroiled most of the nations of Europe  along with Russia, the United States, the Middle East and other regions.

The war pitted the Central Powers mainly Germany, Austria-Hungary, and Turkey against the Allies mainly France, Great Britain, Russia , Italy, Japan and from 1917, the United States.

It ended with the defeat of the Central Powers. It led to the fall of four great imperial dynasties( in Germany, Russia, Austria-Hungary and Turkey) resulted in the Bolshevik Revolution in Russia, destabilization of European society,  laid the groundwork for World War2.

The assassination of the Austrian Archduke Franz Ferdinand was the main catalyst for starting the war.

Learn more about World War 1 here:

https://brainly.com/question/14387086

#SPJ2

1. Calculate
(i) 3¹⁸÷3¹⁵​

Answers

Answer:

3³ is the answer

Explanation:

.......

Answer:

27

Explanation:

3¹⁸ = 387,420,489

3¹⁵​ = 14,348,907

387,420,489/14,348,907 = 27

What was a key focus of the reforms implemented by Nikita Khrushchev?

A. improving relations with the West

B. the reduction of the Soviet nuclear arsenal

C. cracking down on political dissent

D. the de-Stalinization of the Soviet Union

Answers

Answer:

D

Explanation:

Kruschev was the Soviet leader immediately after Stalin, so he would be responsible for removing the Stalin cult of personality from Soviet policy. C would not be a reform, and B would be Gorbachev's future responsibility. A is a possible answer, however I do not believe it is the best one as Khrushchev also made disparaging comments like "We will bury you".

How did benito mussolini rise to power?​

Answers

Answer:

Mussolini's Rise to Power

In 1921, the Italian King Victor Emmanuel III dissolved Parliament amidst growing violence and chaos. Elections brought a huge win for the Fascists, with Mussolini taking a seat as a deputy in Parliament. The party changed its name to Partito Nazionale Fascista.

Hope this helps luv!!...let me know if not.

The mercantile system motivated European countries to explore new lands hoping to do what?
Find gold and silver
Claim territories
Pursue adventure
Grow new crops

Answers

Answer:

Find gold and silver

Explanation:

It is but a trade Centre, their emphasies on monetary metals accords with currents ideas regarding the money supply.

Answer:

Find gold and silver

Explanation:

Mercantilism is the idea that the more gold or silver a nation has, the more powerful the nation.

When a store sells off all of their products, they are _______
their merchandise.
A. retailing
B. discounting
C. liquidating

Answers

C. Liquidating their merchandise

Answer:

c and b

Explanation:

Why was Roosevelt probably more upset about Pearl Harbor than normal?

Answers

maybe he felt bad because his acts was the reason it happened, and because of the Japanese attack on pearl harbor more than 2,300 Americans died of the bombing. aka maybe it was a guilty conscience

1. Explain the roles of products, reactants, and limiting reactant in a chemical reaction.

Answers

Answer:Products and reactants are substances. The first one (the products) are obtained when the reactants are changed. The process of change of one element into another is called chemical reaction. The reactants are transformed during the chemical reaction into products. Limiting reactant is the reactant which defines the amount of product as a a result of the reaction. This reactant is also called limiting reagent.

Explanation: can i get braiest pls

Help i need help. i'm doing a project over national parks in tanzania. i just need facts on them. please help.!

Answers

Explanation:

Nearly 30 Percent of Tanzania is National Parks.Mount Kilimanjaro is the Tallest Mountain in Africa

Select the correct answer. Which central government agency was responsible to provide news on the war? A. The Central Allied News Network B. The Office of War Information C. The Department of War Intelligence D. The Bureau of War Services

Answers

Answer:Out of the three options, the correct one, in my opinion, is option ‘B.’

That is the United States Office of War Information.

The United States Office was also called OWI (short for Office of War Information).

This was an agency which was formed during the second world war.

It was the job of this agency to broadcast information about what was going on in the world war to the local masses.

Explanation:

Answer:

B-The Office of War Information

Explanation:

The OWI served as an important U.S. government propaganda agency during World War II. It documented America's mobilization for the war effort in films, texts, photographs, radio programs, and posters

explain how other civil rights movement pattern themselves after the African-American civil rights movement (20 pts!!)

Answers

Answer:

American civil rights movement, mass protest against racial segregation and ... the civil rights movement of the 1950s and '60s broke the pattern of public ... against their enslavement (see slave rebellions), African Americans and other ... Despite this repression, a growing number of Black Americans freed themselves from

Explanation:

Which Catholic saint is believed to have Christianized the northern half of Ireland A Paul B Peter C Patrick D Jerome​

Answers

Answer:

Saint Patrick

Answer:

c Patrick

Explanation:

Based on the information learned from the videos and what you have learned in the past about Georgia. How was Georgia beginning to change after WWII. List examples and explain.

Marking the Brainliest

Answers

The correct answer to this open question is the following.

Unfortunately, you did not attach the videos or a link to them. we can comment based on our knowledge of the topic.

Georgia began to change after WWII in that the economy of the state started to become more industrial due to the many factories that were used to produce weapons and war supplies. These factories transformed their production to the fabrication of goods to trade. These factories diversified their production and opened jobs so people from the rural areas decided to migrate to large cities, where these industries were located.

For agriculture, technological improvements like tractors and processors made harvesting and planting more efficient. At the end of World War II, the state of Georgia witnessed how agriculture changed due to the invention of new technologies and the support of government programs.

Please help!!!! Best answer will get brainliest

Answers

answer choice b (the new deal) is correct.

hope this helps :)

Answer:

New Deal

Explanation:

The New Deal was a series of programs, public work projects, financial reforms, and regulations enacted by President Franklin D. Roosevelt in the United States between 1933 and 1939.

List 5 majors battles in which john bell hood commanded confederates troops

Answers

Answer:

Peninsula Campaign.

Seven Days Battles. Battle of Gaines's Mill.

Second Battle of Bull Run.

Battle of Antietam.

Battle of Fredericksburg.

Battle of Gettysburg.

Battle of Chickamauga.

Atlanta Campaign.

The Seminole tribe of Florida used
which tactics to resist their removal?
A. Guerrilla
B. Consensus
C. Treaty

Answers

Answer:

a

Explanation:

trust me

How many countries are members of the United Nations?
289
211
152
193

Answers

Answer:

Explanation:

193 member mates!!

Answer:

D

Explanation:

Lol I just know. I had a unit on this in us history

The Georgia Supreme Court and Court of Appeals were created to...

Answers

Answer:

The Court of Appeals has statewide appellate jurisdiction of all cases except those involving constitutional questions, murder, and habeas corpus cases where original appellate jurisdiction lies with the Supreme Court. The Court of Appeals may certify legal questions to the Supreme Court.

Explanation:

Hope it helps

FOLLOW MY ACCOUNT PLS PLS

Supreme Court
Primarily sn
eppalatercours
sociate Justices
Which of the following completes the chart?
Hears criminal and civiles for the first time
Highest ranking judicial body in the United States
Determines the length of sentences for all convicted felons
Selects jurors for all major criminal cases in the United States
Reset
Submit
ved
Session Timer 1794

Answers

Answer:

What is the question in this?

Explanation:

Answer: Highest ranking judicial body in the united states. Hears criminal and civiles for the first time.

Explanation:

\The painting School of Athens by Raphael uses the linear perspective technique. What characteristic does the painting contain? The painting School of Athens showing famous scholars and philosophers engaged in conversation Painting School of Athens byRaphael courtesy the Vatican Museums

Answers

Answer: Some objects in the painting appear to be close, while others seem to be far away.

Explanation:

The School of Athens is simply a fresco by Raphael whom is an Italian Renaissance artist. The School of Athens was painted by 1509 to 1511.

The School of Athens symbolizes philosophy, art and science which depicts the Italian Renaissance. The characteristics of the painting is that some objects in the painting appear to be close, while others seem to be far away.

Read the passage from President Bush's 1991 speech describing relations between the United States and the Sovjet
Union.
Europe has become whole and free, and America's leadership was instrumental in making it possible.
Our relationship to the Soviet Union is important, not only to us but to the world. That relationship has helped
to shape these and other historic changes. ...
... We will maintain our contact with the Soviet leadership to encourage continued commitment to
democratization and reform.
-George Bush,
1991
People who agreed with Bush would most likely have recommended
O sending troops to hasten the breakup of Yugoslavia.
O keeping East and West Germany as separate nations.
O supporting Gorbachev's policies of perestroika and glasnost.
O encouraging the breakup of the Soviet Union.

Answers

Answer:

C

Explanation:

Edge

The perestroika and glasnost are reformation movements and George Bush promoted reform.

The people who agreed with Bush were most likely to recommend supporting Gorbachev's policies of perestroika and glasnost.

Who was President Bush?

George W. Bush, in full George Walker Bush, the 43rd president of the United States (2001–09), who led his country’s response to the September 11 terrorist attacks in 2001 and initiated the Iraq War in 2003.

Narrowly winning the electoral college vote in 2000 over Vice President Gore, Before his election as president, Bush was a businessman and served as governor of Texas (1995–2000).

Therefore from the above statement it is clear that option C, supporting Gorbachev's policies of perestroika and glasnost, is the correct option.

Learn more about President Bush, refer to:

brainly.com/question/15966123

#SPJ2

Other Questions
the winner of a raffle will receive a 21-foot outboard boat. if 2000 raffle tickets were sold and you purchased 50 tickets, what are the odds against your winning boat? Que es una campaa?, que proposito puede tener?, porque medios se puede tranmitir?, que recursos del lenguaje se pueden utilizar en ella? help in pic eeeeeeee Use Trig to Solve this...If you dont know how to use trig in right triangles then DONT answer. A steel bottle contains nitrogen gas at STP. What is the final pressure if the temperature is changed to 155C? Calculate the number of moles in 40g of Al(OH)3 a example of metaphor and explain the metaphor Write a scientific explanation as to What is the main cause of global warming?" What is the relationship between Nike with the Second Industrial Revolution? Which expression is equivalent to 7x(yz - 7 - 2y) A 9-inch diameter pizza has 30 calories per square inch. About how many calories are in the entire pizza?Use 3.14 for pi. Amelia is using substitution to determine if 8 is a solution to the equation. Complete the statements. 6a = 42 for a = 8 First, Amelia must substitute 8 for the using To simplify, Amelia must 8 a solution of the equation. pls hurry I'm on timer what were the social achievements of rana regime? HELP ME PLS! ASAP 10 POINTS FOR THIS ONE & THE NEXT ONE!!!!!! can someone please help me What was Kristallnacht? a. an attack on Jewish homes, businesses, and synagogues in Germany b. a ship full of Jewish refugees denied entry in the United States c. a set of laws denying Jews of their German citizenship, jobs, and property d. a group of highly educated Jewish refugees allowed into the United States Find the circumference and area of a circle A with a diameter of 26 inches. Please I need the answer ASAP. Thank you very much. where did Jewish immigrants to South africa come from what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? Did I do this right? if I didn't get it right can you help me? Thank you!