What is the surface area?

Someone please help

What Is The Surface Area?Someone Please Help

Answers

Answer 1

Answer:

134 square inches

Step-by-step explanation:

To find surface area, you must find the individual area of each face of the shape. There are 6 faces on every cube or other rectangular prism, so you must perform 3 equations, as every face has an identical face on the opposite side. The formula for regular area is Length (l) times Width (w).

Large sides on front and back: 8x6=48

Slim sides to the right and left: 1x6=6

Slim sides on top and bottom: 8x1=8

Then combine:

48+48+6+6+8+8=134


Related Questions

Evaluate 2^3x-1 for x = 1.

Answers

Answer:

4

Step-by-step explanation:

Answer:

this don't make any sense bro

Step-by-step explanation:

what is the number in between 2 3

Find the range of the following data set: 5, 9, 2, 10, 3, 5

Answers

Answer:

8

Step-by-step explanation:

10-2 = 8

The range of a set of data is the difference between the highest and lowest values in the set. To find the range, first, order the data from least to greatest. Then subtract the smallest value from the largest value in the set.

(I found this explanation online)

surface area of 30, 8,20

Answers

Answer:

hjub oubh

Step-by-step explanation:

A cylindrical cup and a cone both have a radius of 5 cm and a height of 8 cm. What is the approximate difference between the volume of the cup and the volume of the cone? A 133 cm B. 267 cm C. 419 cm D. 628 cm​

Answers

Answer:

419

Step-by-step explanation:

CAN SUMONE HEEEELP ME PLEASE I DONT UNDERSTAND LIKE THIS TEACHER REALLY THINK IK EVERYTHING SMH BUT ILL GIVE BRAINLY! thank youuu

Answers

Answer:

16,872

Step-by-step explanation:

Which temperature is warmer, -2 degrees Celsius, or -5 degrees Celsius?
-2
-5

Answers

Answer:

-2 is warmer the -5 degrees

Answer:

-2 Celsius

Step-by-step explanation:

The negative degrees in Celsius work the same way as Fahrenheit

The closer the number is to 0 the warmer the temperature is... -2 is closer to 0 than -5

Find the area of this shape. (Note: the figure is NOT drawn to scale)

Answers

I think if you add: 25 or multiply:420 cm

Answer:

The area of this shape is [tex]50cm^2[/tex].

Step-by-step explanation:

To find the area of this figure, you only need to know the area of the rectangle and the area of the triangle. The area of the rectangle would be 5 * 6 = [tex]30cm^2[/tex]. Since the length of the rectangle plus the base of the triangle is equivalent to 14, that means the base of the triangle is equal to 14 - 6 = 8 cm. The formula for the area of a triangle is [tex]\frac{1}{2} bh[/tex], the base you now know is 8 cm, and the height is 5 cm, which means the area of the triangle would be [tex]\frac{1}{2} *5*8[/tex] = [tex]\frac{1}{2} * 40[/tex] = [tex]20cm^2[/tex]. Add the area of the rectangle to the area of the triangle and you'll get the area of the entire shape, which is 30 + 20 = [tex]50cm^2[/tex].

in the following figure, the value of x is

Answers

Answer:

x≈11.5

Step-by-step explanation:

sin(35)=x/20

x=20*sin(35)≈11.5

What is the answer to this question?

Answers

Answer:

$608.33 or $608.32645 not rounded

Step-by-step explanation:

A=P(1+r/n)^nt P=500 r=0.04 n=1 t=5

A=500(1+0.04/1)^1x5

A=500(1.04)^5

A=500(1.2166529)

A=608.32645

A calculator screen displays 9.837E8. Write this number in standard form.​

Answers

Answer:  983.7 x 10^6

its in the most standard form it can be in now.

The standard form of the given number is 983.7 x 10^6.

We have given that,

The screen displays 9.837E8. Write this number in standard form.​

We have to write the above equation in standard form.

What is the standard form of the number?

The standard form of a number is a way of writing the number in a form that follows certain rules. Any number that can be written as a decimal number, between 1.0 and 10.0, multiplied by a power of 10, is said to be in standard form.

We have given  9.837^8

Therefore the standard form of the given number is  983.7 x 10^6.

To learn more about the standard form of number visit:

https://brainly.com/question/1565680

#SPJ2

A professor compares the number of students at his school majoring in statistics, engineering, both, or neither. If the number of students majoring in both is 20, how large is the population?​

Answers

Answer:

1,946

Step-by-step explanation:

251+175+1500+20=1,946

Which expression is equivalent to 2(3g - 4) - (8g + 3)

Answers

Answer:

4

Step-by-step explanation:

Hope this helps! : )

2(3g - 4) - (8g + 3)

Distributive property

6g - 8 - 8g - 3

Combine like terms

-2g - 11

Answer:

4

Step-by-step explanation:

2(3g-4)-(8g+3)

6g-8-8g-3

-2g-11

Divide (x^3 - 4x^2 - 2x -5) by (x-5)

Answers

Answer:

Quotient = x² + x + 3

Reminder = 10

Step-by-step explanation:

We need to divide , x³ - 4x² - 2x - 5 by x - 5

x - 5) x³ - 4x² - 2x - 5 ( x² + x + 3

- x³ -(+)5 x²

_______________

0 + x² - 2x - 5

x² -5x

__________________

0 +3x - 5

+3x -15

__________________

+10

Where does 8\10 go on a splited number line

Answers

Answer:

image

Step-by-step explanation:

on image, ignore the p, q and r...

Can any on help on 4-6 only please it would be grateful

Answers

Answer:

4. h=9in

5. 150.8[tex]m^{2}[/tex]

6. 301.6[tex]in^{2}[/tex]

Step-by-step explanation:

4.

Surface area of a rectangular prism form : A=2(wl+hl+hw)

Substitute in values from the question: 558=2[(9)(11)+h(11)+h(9)]

Multiply where applicable: 558=2[(99)+11h+9h]

Combine like terms: 558=2[(99)+20h]

Divide both sides by 2: 279=(99)+20h

*note- This step can also be seen as multiplying the right side by 2 without messing with the left at all (558=(198)+40h) then you would solve in the same fashion as I will from here just with the alternative numbering*

Subtract to isolate the h: 180=20h

Divide both sides to isolate the h: 9=h

Now we see that the missing dimension h=9in

*note- I did not bold the equations with squares so please don't be confused by that*

5.

Surface area of a cylinder form: A=2πrh+2π[tex]r^{2}[/tex]

Substitute in values from the question: A=2π(3)(5)+2π[tex]3^{2}[/tex]

Multiply were applicable: A≈94.2+56.5

Add remaining values: A≈150.8

Now we see that the total surface area is 150.8[tex]m^{2}[/tex]

*note- whenever we solve for volume or SA of a figure we square the unit ([tex]m[/tex]➞[tex]m^{2}[/tex])*

6.

Surface area of a cylinder form: A=2πrh+2π[tex]r^{2}[/tex]

Substitute in values from the question: A=2π(6)(2)+2π[tex]6^{2}[/tex]

*note- we use 6 instead of the given value 12 because the equation calls for the radius and not the diameter*

Multiply were applicable: A≈75.2+226.2

Add remaining values: A≈301.6

Now we see that the total surface area is 301.6[tex]in^{2}[/tex]

*note- whenever we solve for volume or SA of a figure we square the unit ([tex]in[/tex]➞[tex]in^{2}[/tex])*

Hope this helps :)

what does Actual - Predicted =?

Answers

Answer:

Step-by-step explanation:

Another volume question and dw it’s not a test its just a assignment that just stress me out

Answers

Answer:

volume = 337.2 ft³

Step-by-step explanation:

volume = base x height = 84.3 x 4 = 337.2 ft³

x ≤ 12 Is x=3 a solution?
yes or no

Answers

Answer:

yes

Step-by-step explanation: :)

Answer: yes

Step-by-step explanation:

If x = 2, y = 3 and z = 4, calculate the value of each of the following algebraic expression: 2z - 3x =

Answers

Answer:

the answer is 2

Step-by-step explanation:

2(4)-3(2)=

8-6=2

A . Yes, the pre-image and image are both line segments and the line segment had been translated
B . No the pre-image and image are not both line segments
C . No the image shown has not been translated but another transformation has taken place
D . No the translation did not preserve the segment length

Answers

Answer:D . No the translation did not preserve the segment length

Step-by-step explanation:

What is the answer to 1+1

Answers

Answer:

2

Step-by-step explanation:

Answer:

2

Step-by-step explanation:

1+1=2 Now give me brainliest plz

Item 1
Which measurement is equivalent to 1 kilogram?

10,000 grams

1,000 grams

100 grams

10 grams

Answers

1000 grams. 1 kilogram is equivalent to 1000 grams

Graph the linear equation
y=-5

Answers

Answer:

Answer in the picture: x = 1 | y = -5

Step-by-step explanation:

Not sure if that's the answer you're looking for but I think that's it

Your newer is in the image



How does the graph of f(x) = 3|x+2|+4 relate to its parent function?
A. The parent function has been translated to the left.
B. The parent function has been stretched.
C. The parent function has been compressed.
D. The parent function has been translated up.

Answers

Answer:

If the parent function is f(x)=|x+2|+4 and it is moved to the left 2 units vertically stretched by a factor of 3 and moved up by 4 units in that order because to move a function to left c units, add c to every x to vertically stretch function by a factor of c, multiply the whole function by c to move function up c units, add c to the whole function so it is 2 to the left, vertically stretched by a factor of 3 then moved up 4 units.

The points relates to parent function are:

The parent function was translated upward. The parent function was moved to the left. The parent function has been overburdened.

What is a parent function?

In mathematics, a parent function is the simplest function in a family of functions that maintains the definition of the entire family.

In graphing, the parent function is the basic equation where the graph is not transformed. A straight line, for example, has a parent function of y=x. The equations from such transformations will still be part of the family of lines if this graph is translated, reflected, rotated, or dilated.

The graph depicts the function f(x) - 3|x+2|+4.

The parent function was translated upward.

The parent function was moved to the left.

The parent function has been overburdened.

Learn more about Transformation here:

https://brainly.com/question/16089995

#SPJ7

If the probability that the Islanders will beat the Rangers in a game is 78%, what is
the probability that the Islanders will win at least five out of six games in a series
against the Rangers? Round your answer to the nearest thousandth.
Answer:
Submit Answer

Answers

Answer:

(17/25)^5 = 0.145393 = 14.539%

Step-by-step explanation:

78% = 78/100 or 17/25 simplified

probability of winning each game is 17/25

The probability that the Islanders will win at least five out of six games in a series against the Rangers is 0.4.

What is probability?

Probability deals with the occurrence of a random event. The chance that a given event will occur. It is the measure of the likelihood of an event to occur.The value is expressed from zero to one.

For the given situation,

The probability that the Islanders will win the Rangers in a game = 78%      ⇒ [tex]0.78[/tex]

The probability that the Islanders will lost the Rangers in a game is

⇒ [tex]1-0.78=0.22[/tex]

The probability that the Islanders will win at least five out of six games in a series against the Rangers is

⇒ [tex]6C_{5} (0.78)^{5}(0.22)^{1}[/tex]

⇒ [tex](6)(0.2887)(0.22)[/tex]            [∵ [tex]6C_{5} =6[/tex]]

⇒ [tex]0.3811[/tex] ≈ [tex]0.4000[/tex]

Hence we can conclude that the probability that the Islanders will win at least five out of six games in a series against the Rangers is 0.4.

Learn more about probability here

https://brainly.com/question/10377907

#SPJ3

Someone help and PLEASE make sure it’s right

Answers

Answer:

Acute angle, doesn't have a 90 degree angle to be a right triangle, neither a wide angle to be an obtuse triangle.

write these numbers in order of size starting with the smallest number. 5 to the power of -1, 0.5, -5, 5 to the power of 0​

Answers

Answer:

5^-1, 0.5, 5^0

Step-by-step explanation:

Convert all numbers so that they have the same format.

5^-1 = 0.2

5^0 = 1

Compare:

0.2 < 0.5 < 1

This would be the order of size starting with the smallest.

Make sure you use the numbers in the problem and not the ones that were simplified.

FREE PTS! If you were to go to any dream reality, where would you go? ​

Answers

Answer:

I would be in vampire diaries world bc why not

Answer:

I would go to a dream reality where I could hop into any book, or fanfiction of my choosing, and actually talk and communicate with the characters, with all the characters knowing I was always there, just didn't talk to me much, and if the people there have powers, I can choose mine.

Step-by-step explanation:

which weights more 2.48 or 2.5​

Answers

2.5 weighs more. It’s a greater number than 2.48

Consider the sequence 20, 14, 8, 2, -4, ....
(a) Write a recursive rule to represent the sequence.
(b) Write an explicit rule to represent the sequence.
(c) Find the 30th term in the sequence.
The BEST answer gets brainliest!! Hurry now!

Answers

[tex](a)\quad a_{n+1}=a_n-6\\\\(b)\quad a_1=20,\ d=2-8=-6\implies a_n=20+(-6)(n-1)\\\\{}\qquad a_n=-6n+26\\\\(c)\quad a_{30}=-6\cdot30+26 = -154[/tex]

Other Questions
What is the relationship between Nike with the Second Industrial Revolution? Which expression is equivalent to 7x(yz - 7 - 2y) A 9-inch diameter pizza has 30 calories per square inch. About how many calories are in the entire pizza?Use 3.14 for pi. Amelia is using substitution to determine if 8 is a solution to the equation. Complete the statements. 6a = 42 for a = 8 First, Amelia must substitute 8 for the using To simplify, Amelia must 8 a solution of the equation. pls hurry I'm on timer what were the social achievements of rana regime? HELP ME PLS! ASAP 10 POINTS FOR THIS ONE & THE NEXT ONE!!!!!! can someone please help me What was Kristallnacht? a. an attack on Jewish homes, businesses, and synagogues in Germany b. a ship full of Jewish refugees denied entry in the United States c. a set of laws denying Jews of their German citizenship, jobs, and property d. a group of highly educated Jewish refugees allowed into the United States Find the circumference and area of a circle A with a diameter of 26 inches. Please I need the answer ASAP. Thank you very much. where did Jewish immigrants to South africa come from what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? Did I do this right? if I didn't get it right can you help me? Thank you! Determine which number is a solution to the inequality. These four numbers are plotted on a number line:-23,58,-35,-12Which is the correct ordering on the number line, from left to right? A . -12,-35,-23,58 B. -12,-35,58,-23 C. -23,-35,-12,58 D. -35,-23,-12,58 Mahi has 31 rolls of string. Each roll holds 12 yards of string. How many feet of string does she have? can anyone tell me my mistakes pls? Help me pleas I need help to solv this problem please help worth 20 points Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Please help I need this done!Will give the brainliest!