There are _ total possible outcomes.

There Are _ Total Possible Outcomes.

Answers

Answer 1

Answer:

20 possible outcomes

Step-by-step explanation:


Related Questions

When calculating total wall length, do you include the lengths of windows and doors? Or exclude them?

Answers

You calculate wall-length like this.

Measure the length of each wall including doors and windows. Find the total square feet of the wall(s) by multiplying ceiling height by total wall length. Subtract areas that will not be covered.

The ships kitchen stocks 1 3/5 quarts of ice cream for every 1/4 cake. There are 10 cakes in the kitchen. How many quarts of ice cream are there?

Answers

Answer:

it should be 11.85 if it's not I do not know what is the answer to it

Answer:

actually the answer is 64

Step-by-step explanation:

Select the statement that describes the expression (one fourth x 8 + 3) ÷ 5.

Add three to the quotient of one fourth and 8, then divide by 5
one fourth times the product of 8 and 3, then divide by 5
Add 3 to the product of one fourth and 8, then divide by 5
Add 3 to the sum of one fourth and 8, then divide by 5

Answers

Answer: B. One fourth times the product of 8 and 3, then divide by 5.

A figure is shown.

What is the value of m?
___ degrees

Answers

Answer:

58°

Step-by-step explanation:

Good luck , hope it helped you :)

Answer:

58 degrees

Step-by-step explanation:

Since a straight line is 180 degrees then we can find out the two missing angles within the triangle.

180-126=54

180-112=68

54+68=122

180-122=58

m=58 degrees

Hope this helps :)

AHH IM BEGGING OMG YOU DONT KNOW HOW IMPORTANT THIS IS I WILL GIVE BRAINLIEST AND I WILL BE FOREVER GREATEFUL PLSSSSS

Owen can type 30 and 2/3 words in 2/35 of a minute. What is his rate in words per minute?

Answers

Answer:

Owen can type 536 2/3 per minute

Step-by-step explanation:

let me know if this is wrong

Please helppp thanksss

Answers

Y-intercept
(0,-2)
x-intercept
(5,0)

Choose the function whose graph is given by

Answers

Answer:

D

Step-by-step explanation:

I plugged each equation into a graphing calculator and compared them to see which one matched the one in the picture.

The value of the trigonometric equation after transformation is given by the value y = 3 [ sin ( x + 3 ) ] - 2

How does the transformation of a function happen?

The transformation of a function may involve any change.

Usually, these can be shifted horizontally (by transforming inputs) or vertically (by transforming output), stretched (multiplying outputs or inputs), etc.

If the original function is y = f(x), assuming the horizontal axis is the input axis and the vertical is for outputs, then:

Horizontal shift (also called phase shift):

Left shift by c units: y=f(x+c) (same output, but c units earlier)

Right shift by c units: y=f(x-c)(same output, but c units late)

Vertical shift:

Up by d units: y = f(x) + d

Down by d units: y = f(x) - d

Stretching:

Vertical stretch by a factor k: y = k × f(x)

Horizontal stretch by a factor k: y = f(x/k)

Given data ,

Let the parent function be represented as f ( x )

Now , the value of the trigonometric function f ( x ) is

f ( x ) = 3sin ( x )

when the function is translated 3 units to the left and 2 units down , we get

y = 3 [ sin ( x + 3 ) ] - 2

Therefore , the transformed function is y = 3 [ sin ( x + 3 ) ] - 2 and the graph is plotted

Hence , the transformed function is y = 3 [ sin ( x + 3 ) ] - 2

To learn more about transformation of function click :

https://brainly.com/question/26896273

#SPJ7

Please answer fast, it’s due in a hour.

Answers

Answer:

100.48 units³

Step-by-step explanation:

Volume of Cylinder: V = πr²h

volume = pi × radius² × height

V = 3.14 × 2² × 8

V = 100.48 units³

Answer:

100.84^units

Step-by-step explanation:

at a pizza shop you can choose thick or thin crust red or white sauce and toppings a pepperoni and cheese or vegetarian. create a tree diagram to display the same space

Answers

Answer:

Total 2*2*3 = 12 outcomes

------------------------------------------------------------------------

                                 >  thick, white, pepperoni  

                 White  >  >  thick, white, cheese          

                                 >  thick, white, vegetarian

Thick  > >

                                 > thick, red, pepperoni  

                   Red  >   >  thick, red, cheese

                                 > thick, red, vegetarian

------------------------------------------------------------------------

                                 > thin, white, pepperoni

                  White  >  > thin, white, cheese

                                  > thin, white, vegetarian

Thin  > >

                                > thin, red, pepperoni

                   Red  >  >  thin, red, cheese

                                >  thin, red, vegetarian

Move the center of the circle to a different location, and record the required values in the table. Check the boxes for the area of the circle and the area of the sector after you move the center. Round the values to two decimal places.

Answers

Answer: answer in the image

Step-by-step explanation:

Answer:

Step-by-step explanation:

Which is NOT a function?
A y – x = 6
B y = 2x
C x = -2
D y + x = 12

Answers

Answer:

D

Step-by-step explanation:

Answer:

d

Step-by-step explanation:

A bag contains to White blocks and one red block and 3 purple blocks what is the sample space of picking a block from the bag

Answers

Answer:

1/36

Step-by-step explanation:

Probability is the likelihood of chance that an event will occur. Mathematically,

Probability = expected outcome/total outcome

If a bag contains two white blocks, one red block and 3 purple block

Total outcome = 2+1+3= 6

Probability that white ball is selected = 2/6

Probability that red ball is selected = 1/6

Probability that white ball is selected = 3/6

Probability of picking a ball is 2/6 × 1/6 × 3/6

Probability of picking a ball = 6/216

Probability of picking a ball = 1/36

Michael is measuring fabric for the costumes of a school play he needs 11.5 meters of fabric. He has 280 centimeters of fabric. How many more centimeters does he need ?

Answers

Answer:

8.7

Step-by-step explanation:

The answer is 8.7 because 280 centemiters converted into meters is 2.8 and 11.5-2.8=8.7

A silicon wafer is textured to minimize light reflection. This results in a surface made up of square pyramids. Each triangular face of one of the pyramids has a base of 5 micrometers and a height of 5.6 micrometers. Find the surface area of the pyramid, including the base.

Answers

Answer:

86.33 square micrometers

Step-by-step explanation:

A silicon wafer is textured to minimize light reflection. This results in a surface made up of square pyramids. Each triangular face of one of the pyramids has a base of 5 micrometers and a height of 5.6 micrometers. Find the surface area of the pyramid, including the base.

The formula for the Surface Ares mma is given as :

A=a² + 2a √a²/4+ h²

a = base edge = 5 micro meters

h = height = 5.6 micro meters

=5²+2× 5 × √5²/4+ 5.6²

= 86.32699 square micrometers

≈ 86.33 square micrometers

We can rewrite the expression 16+8 as 8 x (2+1). Notice that 8 is the greatest factor of 16 and 8. Use this same method to rewrite the expression 24+36 as the product of the greatest common factor of 24 and 36 and the sum of the remaining numbers. 24 + 36 = ____________

Answers

Answer:

60

Step-by-step explanation:

24+36=60

Answer:

60

Step-by-step explanation:

24+36=60

A 12-foot ladder is propped against a vertical wall. The top end is 11 ft above the
ground. What is the measure of the angle formed by the ladder with the ground?

If you plan on giving me a link just keep moving. Don’t even stop to answer this. The. links. don’t. Help.
But if you can actually answer the question and help me understand how you got it that would be awesome.

Answers

Answer:

it's prolly a 45 degree angle of less if the top is 11 feet off the ground

Step-by-step explanation:

if you think about it you get the picture in your head of the room and the position of the ladder against the wall. hope it helps

HELP!! Multiply and simplify and express as a mixed number


12 x 3/8
no links or files

Answers

Answer: 4 and 1/2

Step-by-step explanation: Ok so 12 is a whole number so to turn it into a fraction put it over one as in 12/1.

Then just multiply 12/1 x 3/8 which equals 36/8 But we aren't done!

now we must calculate how many times 8 goes into 36 without going over 36 which is 4. 8 times 4 is 32 so we have 4 leftover. Now writing this as a fraction is 4   4/8. 4 is the whole number and that 4 represents 8 going tinto 36 4 times like we just demonstrated. since 36-32 is 4 thats how you get a 4/8 as your fraction.

Then you just simplify your fraction and 4  4/8 turns into just 4   1/2.

I really hope I explained this well and you understand it! :)

You have $210 and save $5 a week. Your friend has $265, saves nothing, and spends $10 a week. Determine how many weeks it will take before you have more money than your friend.

a. 4 weeks

b. 3 weeks

c. 2 weeks

d. 6 weeks

Answers

Answer:

This answer is A

Step-by-step explanation:

Im fast to answer :)

Find the 75th term: 88, 81, 74, 67, 60

Answers

Answer:

a₇₅ = - 430

Step-by-step explanation:

There is a common difference between consecutive terms, that is

d = 81 - 88 = 74 - 81 = 67 - 74 = 60 - 67 = - 7

This indicates the sequence is arithmetic with nth term

[tex]a_{n}[/tex] = a₁ + (n - 1)d

where a₁ is the first term and d the common difference

Here a₁ = 88 and d = - 7 , then

a₇₅ = 88 + ( 74 × - 7) = 88 - 518 = - 430

The 75th term of the arithmetic progression is -430

What is Arithmetic Progression?

An arithmetic progression is a sequence of numbers in which each term is derived from the preceding term by adding or subtracting a fixed number called the common difference "d"

The general form of an Arithmetic Progression is a, a + d, a + 2d, a + 3d and so on. Thus nth term of an AP series is

Tn = a + (n - 1) d, where Tₙ = nth term and a = first term.

Here d = common difference = Tₙ - Tₙ₋₁

Sum of first n terms of an AP : Sₙ = ( n/2 ) [ 2a + ( n- 1 ) d ]

Given data ,

Let the Arithmetic progression be = 88 , 81 , 74 , 67 , 60 ...

The first term of the AP is a ₁= 88

Now , the common difference of the AP d = second term - first term

                                                                      = 81 - 88

                                                                      = -7

Now , the nth term of the arithmetic progression is given by ,

Tn = a + (n - 1) d

Substituting the values in the equation , we get

T₇₅ = 88 + ( 75 - 1 ) ( -7 )

     = 88 + 74 ( -7 )

     = 88 - 518

     = -430

Therefore , the value of T₇₅  is  -430

Hence , The 75th term of the arithmetic progression is -430

To learn more about arithmetic progression click :

https://brainly.com/question/1522572

#SPJ2

PLEASE HELP!!!!! Thank you!! Will mark brainliest!!!
| x+14 | = 14
| x-14 | = 14
| x+8| = x+8

Answers

Answer:

if youre just looking for x, it would be x=0.

Step-by-step explanation:

the absolute value of any number is just the positive version of that number. So, |0+14|=14 and the same for the rest of them.

What is the area of a rectangle that is 1 1 4 1 4 1 ​ 1, start fraction, 1, divided by, 4, end fraction meters long and 3 4 4 3 ​ start fraction, 3, divided by, 4, end fraction of a meter wide?

Answers

Answer:

4 11/16 m²

Step-by-step explanation:

The formula for the area of a rectangle = Length × Width

From the question:

Length = 1 1/4 m

Width = 3 3/4m

Area of the rectangle =

1 1/4 m × 3 3/4 m

= 5/4 m × 15/4 m

= 75/16 m²

= 4 11/16 m²

Area of the rectangle = 4 11/16 m²

In a 30° -60° -90° triangle, what is the length of the hypotenuse when the shorter leg is 8 m? Enter your answer in the box.

Answers

Answer:

16

Step-by-step explanation:

In a 30 60 90 degree triangle, the hypotenuse is always double the shorter leg. Hope this helps! :)

The hypotenuse of the 30-60-90 triangle whose shorter leg is 8 m is: 16 m.

What is the 30-60-90 Triangle?

The 30-60-90 triangle is a right triangle whose hypotenuse length is always twice the length of the its shorter leg.

Given a 30-60-90 triangle whose shorter leg is 8 m long, therefore:

Hypotenuse of the 30-60-90 triangle = 2(length of the shorter leg)

Hypotenuse of the 30-60-90 triangle = 2(8)

Hypotenuse of the 30-60-90 triangle = 16 m.

Learn more about the 30-60-90 triangle one:

https://brainly.com/question/26097705

hey cutie pls help me thank u !!

f(x)= 2x-1
g(x)=3x
h(x)=x^2 + 1

Compute the following:
Find f(3)

Choose the best answer
A)9
B)5
C)10​

Answers

f(3)=5 // f(3)=2(3)-1 = 5

Two trains are traveling toward each other, on parallel tracks. Train A is moving at a constant speed of 70 miles per hour. Train B is moving at a constant speed of 50 miles per hour. The trains are initially 320 miles apart. How long will it take them to meet?

Answers

Ummm I don’t know what it is

A rectangle has a perimeter of 30 yards. If one side is 5 yards long, how long is the other side?
A. 15 yards
B. 25 yards
C. 10 yards
D. 30 yards

Answers

Answer:

C. 10

Step-by-step explanation:

5+5=10

10+10=20

10+20=30

Answer:

The other is 10 yards long

Step-by-step explanation:

For a given rectangle

Perimeter (P) = 30 yards

and one of rectangle is 5 yards

Now,

Perimeter of rectangle

P = 2l + 2b

30 = 2(5) + 2b

30 = 10 + 2b

30 - 10 = 2b

20 = 2b

b = 20 ÷ 2

b = 10 yards

Thus, The other is 10 yards long

-TheUnknownScientist

Find the value of f(7)

Answers

Answer:

f(7) = - 5

Step-by-step explanation:

Locate x = 7 on the x- axis, go vertically down to meet the graph at (7, - 5 )

Then the value of f(7) = - 5

can someone please help me

Answers

Answer:

21

Step-by-step explanation:

21

What is the percent of change from 56 t0 22

Answers

idea 34 I did 56-22 0.0

Answer:

I think it is -60.71428571 percent.

Find the value of x. Round your answer to the nearest tenth.



x≈

Answers

Answer:

You did not give us an equation :\

You didn’t give us the equation

Brain Teaser! Will be posting till I run out! Winner gets a brainliest!

Question: Find the area of the red triangle.

Answers

Answer:

i tried

Step-by-step explanation:

im suppose to be gifted... it took me 20 minutes and im in 9th grade RIP, but is it 9??

Other Questions
Que es una campaa?, que proposito puede tener?, porque medios se puede tranmitir?, que recursos del lenguaje se pueden utilizar en ella? help in pic eeeeeeee Use Trig to Solve this...If you dont know how to use trig in right triangles then DONT answer. A steel bottle contains nitrogen gas at STP. What is the final pressure if the temperature is changed to 155C? Calculate the number of moles in 40g of Al(OH)3 a example of metaphor and explain the metaphor Write a scientific explanation as to What is the main cause of global warming?" What is the relationship between Nike with the Second Industrial Revolution? Which expression is equivalent to 7x(yz - 7 - 2y) A 9-inch diameter pizza has 30 calories per square inch. About how many calories are in the entire pizza?Use 3.14 for pi. Amelia is using substitution to determine if 8 is a solution to the equation. Complete the statements. 6a = 42 for a = 8 First, Amelia must substitute 8 for the using To simplify, Amelia must 8 a solution of the equation. pls hurry I'm on timer what were the social achievements of rana regime? HELP ME PLS! ASAP 10 POINTS FOR THIS ONE & THE NEXT ONE!!!!!! can someone please help me What was Kristallnacht? a. an attack on Jewish homes, businesses, and synagogues in Germany b. a ship full of Jewish refugees denied entry in the United States c. a set of laws denying Jews of their German citizenship, jobs, and property d. a group of highly educated Jewish refugees allowed into the United States Find the circumference and area of a circle A with a diameter of 26 inches. Please I need the answer ASAP. Thank you very much. where did Jewish immigrants to South africa come from what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? Did I do this right? if I didn't get it right can you help me? Thank you! Determine which number is a solution to the inequality.