need help which contemporary art career best fits this description - a photographer b fashion designer or c multi media designer description uses comp aided design is considered glamorous is good at predicting the future and follows trends and can be useful to rental chains

Answers

Answer 1

Answer:

yeah the answer is c

Explanation:

Answer 2

Answer:

the correct answer is c) multimedia designer

Explanation:


Related Questions

I have a Question about something

Answers

Answer:

?

Explanation:

Answer:

what is it?

Explanation:

What is gravity?

a concentration of mass and energy

another term to describe the law of darkness

bodies with opposite charges

energy that pulls things toward the center of the earth

Answers

Answer:

D. Energy that pulls things towards the Earth

Explanation:

Answer:

energy that pulls things towards the center of the earth

Explanation:

Gravity helps maintain and balance the earth. Such as us standing, sitting down, a lunch box on the ground, a pair of shoes on a shelf. It balances everything so that we don't move slow or fast.

One thing I don't know why
It doesn't even matter how hard you try
Keep that in mind, I designed this rhyme
To explain in due time

All I know
Time is a valuable thing
Watch it fly by as the pendulum swings
Watch it count down to the end of the day
The clock ticks life away...

hi

Answers

Uh, who is that by? I'd like to read it.

hi yea yea yea yea yea

Explain how you think linear perspective changed the quality of art following its birth in the Renaissance period.

Answers

Answer:

Linear perspective change the quality of art following its birth in the Renaissance period because they wanted the art to be more realistic and they believed one way to achieve it was to use the method of linear perspective. It uses the principle of math to realistically portray space and depth in art.

Explanation:

Hope this helps

Answer:

Linear perspective change the quality of art following its birth in the Renaissance period because they wanted the art to be more realistic and they believed one way to achieve it was to use the method of linear perspective. It uses the principle of math to realistically portray space and depth in art.

Explanation:

Can you mix a color in with lavender to make green?​

Answers

Answer:

I would think no, because to make green you need blue and green. Lavender is a complimentary color, so you wouldn't be able to mix green with it.

Explanation:

Have a nice day!

what i can do activity 1.1 my star record

Answers

Could you rewrite this, because it's pretty hard to understand??

Star Music is officially known as Star Records. It is a record label in the Philippines owned and operated by media conglomerate ABS-CBN Corporation.

As a learner, STARS is a web-based programme owned by Student Affairs and Development Division used to manage societies and clubs such as register a new society and record the activities of societies or club and the participants were given point based on their commitment.

Functions of the STARS record

All approved programmes are to be recorded in the STARS by the appointed Liaison Officer at Kulliyyah/Centre/Division/Office/Institute/Mahallah.

learn more about STARS record: https://brainly.com/question/24696035

Does anyone have any drawings they want to share, friend request me if you are a good artist.

Answers

Answer:

ok

Explanation:

How can I achieve becoming an actor one day or a Train Drive? Plz help me out

Answers

Answer:

You can't really become an actor and train driver in one day. You gotta work for that.

Explanation:

Tell me the 3 best things about you.

Answers

1: how i’m good at advice or wtv
2: i like to believe i’m trustworthy yk
3: i know how to drop toxic people.

Describe the message each artist wanted to convey to the observer

Answers

Answer:Describe the message each artist wanted to convey to the observer. Bird in Space: The artist wanted to convey the graceful qualities of the bird. ... Audubon wanted to show that even though the painting is of a wild turkey, a less beautiful bird, there is still some beauty to his artwork.

Explanation:

i want to get an animation tablet but the one with the screen. do anyone knows which animation tablet is the best

Answers

Answer:

Apps:

ibisPaintX (draw or edit)

Flip a Clip (animate)

Jotr (draw)

Explanation:

Do u mean a app or a electronic?

Heres and example of what i do:

And this is the app ibisPaintX

Answer:

Well, you could just use a normal tablet! ya just got to use a apple pen. But the legitimate animation tablet? I dont know, but if you look through amazon im sure there are good brands! ^^

sayori~
please give me critiques even if it isnt nice i want to improve!!

Answers

Answer:

i think it looks good! (constructive critisism) maybe you could try to further develop your style into the drawing

Explanation:

¿Qué significa emitir un voto responsable e informado por el bienestar propio y el de todas las peruanos y peruanos?

Answers

Answer:

Aquí tienes Otra responsabilidad de los ciudadanos es votar. La ley no requiere que los ciudadanos voten, pero votar es una parte muy importante de cualquier democracia. Al votar, los ciudadanos participan en el proceso democrático. Los ciudadanos votan por líderes que los representen a ellos y a sus ideas, y los líderes apoyan los intereses de los ciudadanos.

Explanation:

Espero que esto ayude un poco

Which statement best describes Snoopy—Early Sun Display on Earth by Alma Thomas?


It has shapes and colors quickly arranged with little planning.


It has small shapes arranged into vertical columns.


It has shapes and colors that are true-to-life.

Answers

Answer:

It has small shapes arranged into vertical columns.

a detailed analysis and of Olmec art

Answers

Between 1200 and 400 B.C., the Gulf Coast states of Veracruz and Tabasco in Mexico were the setting for a major cultural and artistic florescence among peoples now collectively known as Olmec, named after the Aztec word for the region (Olman, “place of rubber”). Olmec art is best known for colossal sculpture in volcanic stone and intricate works in jade, both media that were imported from faraway regions. Olmec artists were revolutionary for their time, establishing the first major widespread styles in Mesoamerica, laying the foundation for later innovation from the central Mexican metropolis of Teotihuacan south to the Maya area.

After the spread of maize agriculture in the Early Formative period (ca. 1800–1200 B.C.), people in the river valleys of Olman cooperated to construct monumental earthen platforms and mounds at the site of San Lorenzo, Veracruz. More research is needed to know about the society at San Lorenzo: for example, what they ate, where they lived, what they believed. They shared the common goal to invest in major building projects, engineering structures and creating large gathering spaces that transcended the functional needs of daily life. Evidence from the nearby site of El Manatí demonstrates that people were creating sculptures out of wood and stone early in San Lorenzo’s history. Rubber balls found at El Manatí are also some of the earliest evidence for the importance of a ballgame to Olmec peoples.

What was the main song that was used in FIFA World Cup back in 2010? What were the lyrics?

Answers

Answer:

This Time for Africa

Explanation:

We should all know Shakira

Answer: waka waka

Explanation:

Who painted the above image?

Answers

Answer:

Robert Henri

Explanation:

The image is painted by the Robert Henri.

Who was Robert Henri?

Robert Henri was a painter and teacher in America. He was the son john Jackson Cozad who was a professional gambler and the real estate developer.

Robert Henri painted a beautiful painting that describes the snow fall in New York. It is an oil painting which he created in 1902. It shows the image of the street with a dark surroundings.

Thus the creator of the painting is Robert Henri.

Learn more about paintings here:

https://brainly.com/question/15008921

#SPJ2

Using complete sentences post a detailed response to the following.

Why is Italian the language of musical terminology?

Answers

Answer:

to ur question

Explanation:

because of the vast majority of the important early composers , from the Renaissance to the Baroque period were Italian

What is one great thing that you can do with your character during a pause in movement?

there is little you can show during this type of pause

offer a short concert

let the audience take a nap

show your character thinking

Answers

Answer: I would say show your character thinking

Explanation: During a characters movement, a good way you are able to pause is by having your character think of something, which could transition through the plot. That is my best guess and I hope this helps

Ti⊂k∫∈s ω∅∅p

Answer: Show your character thinking

is anyone going to the Florida cheer competition on Saturday and Sunday at universal studios??

like I just want to know ​

Answers

Answer:

yaa! mark me brainliest!I;m going!

Explanation:

Answer:

nope

Explanation:

im answering for points but no

True or False: You cannot beam more than 2 eighth notes together.

Answers

Answer:

false

Explanation:

is my drawing good enough to submit to my teacher?
also 50 points because i have 900

Answers

Answer:

YES!

Explanation:

This tells us which notes to play sharp or flat in music

A. Key signature

B. Accidental

C. Flat

D. Sharp

Answers

A. key signature , the key signature is a list of all the sharps and flats in the key that the music is in.
A


Helped? I hope so

.
An angry person shaking a fist while shouting is an example of what technique that is often used in animation to enhance spoken words or express feeling?

sign language

panning movement

gestures

lip syncing

Answers

Answer:

i believe its gestures

Explanation:

dkdkiddidididididiidjfnrjr

gestures would be the most reasonable answer

Which statement best describes Snoopy—Early Sun Display on Earth by Alma Thomas?


It has shapes and colors quickly arranged with little planning.


It has small shapes arranged into vertical columns.


It has shapes and colors that are true-to-life.

Answers

Answer:

Alma Thomas describes the colors as a unity, thus, the C statement

Explanation:

Every shape in the paintings does not have a bright color and every shape does not have an exact same size. Alma Thomas describes the colors as a unity, thus, the C statement is the most suitable answer to the question.

ano ang pagkakaiba at pagkakaparehas ng balanghay at vinta?

Answers

Answer:

Is this tagalog?

Explanation:

Is that question racist?

The arrangement of values in a drawing leads to the illusion of a light source.

True

False

Answers

Answer:

Explanation:

I think true

hope it helps you thank my question and mark me as brainlist

Which light has internal shutters and accepts a gobo pattern for effects? Single choice. (1 Point) PAR Can Ellipsoidal Reflector Spotlight Strip Lights Cyclorama Floodlights Followspot

Answers

Answer:

Explanation:

pink

Which statement describes Joan Miró's surreal paintings?


They express great sadness.


They are dreamlike with fantasy and imagination.


They look mature rather than childlike.


They are very realistic.

Answers

Answer: They express great sadness.

Explanation: because Surrealism which means a cultural movement, so that means it has qualities of fantasy, so the answer is A.

Which Key feature of Jazz is defined as "a certain rhythmic feel?"

Answers

Answer:

Ensemble Stuff title ; Jazz and rock share a variety of characteristics—ensemble sizes; links to popular ... certain tonality, a certain dynamic level, and a certain rhythmic feel

Explanation:

hope this helps a lil

Other Questions
can someone please help me What was Kristallnacht? a. an attack on Jewish homes, businesses, and synagogues in Germany b. a ship full of Jewish refugees denied entry in the United States c. a set of laws denying Jews of their German citizenship, jobs, and property d. a group of highly educated Jewish refugees allowed into the United States Find the circumference and area of a circle A with a diameter of 26 inches. Please I need the answer ASAP. Thank you very much. where did Jewish immigrants to South africa come from what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? Did I do this right? if I didn't get it right can you help me? Thank you! Determine which number is a solution to the inequality. These four numbers are plotted on a number line:-23,58,-35,-12Which is the correct ordering on the number line, from left to right? A . -12,-35,-23,58 B. -12,-35,58,-23 C. -23,-35,-12,58 D. -35,-23,-12,58 Mahi has 31 rolls of string. Each roll holds 12 yards of string. How many feet of string does she have? can anyone tell me my mistakes pls? Help me pleas I need help to solv this problem please help worth 20 points Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Please help I need this done!Will give the brainliest! how many cm are in 84.363 km Why was Winston Churchill opposed to Neville chamberlain signing the Munich pact ? Many Americans are continuing to work well into their 60s and beyond. About 20% of America's workforce is made up of people who are 55 years old or older. Instead of not working during their golden years, people are choosing to stay employed. Some still work because they want to remain active and productive. Others still work because they need the income. Whatever the reason, many government agencies predict that the number of older people in the workforce will continue to grow.Based on the passage, what does the euphemism golden years mean? A. generation B. old age C. existence D. early life It take 38.70cm of 1.90 NaO4 to neutralize 10.30cm of H2So4 in a battery. Calculate the molar concentration of H2So4 What are the dimensions of this matrix?7 8 6 3 You are on a road trip and have driven 24 miles, which is 3/4 of the total distance.What is the total distance of this trip?