If you dig a 20 foot hole how deep is that hole

Calculate the number of moles in 40g of Al(OH)3 a example of metaphor and explain the metaphor Write a scientific explanation as to What is the main cause of global warming?" What is the relationship between Nike with the Second Industrial Revolution? Which expression is equivalent to 7x(yz - 7 - 2y) A 9-inch diameter pizza has 30 calories per square inch. About how many calories are in the entire pizza?Use 3.14 for pi. Amelia is using substitution to determine if 8 is a solution to the equation. Complete the statements. 6a = 42 for a = 8 First, Amelia must substitute 8 for the using To simplify, Amelia must 8 a solution of the equation. pls hurry I'm on timer what were the social achievements of rana regime? HELP ME PLS! ASAP 10 POINTS FOR THIS ONE & THE NEXT ONE!!!!!! can someone please help me What was Kristallnacht? a. an attack on Jewish homes, businesses, and synagogues in Germany b. a ship full of Jewish refugees denied entry in the United States c. a set of laws denying Jews of their German citizenship, jobs, and property d. a group of highly educated Jewish refugees allowed into the United States Find the circumference and area of a circle A with a diameter of 26 inches. Please I need the answer ASAP. Thank you very much. where did Jewish immigrants to South africa come from what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? Did I do this right? if I didn't get it right can you help me? Thank you! Determine which number is a solution to the inequality. These four numbers are plotted on a number line:-23,58,-35,-12Which is the correct ordering on the number line, from left to right? A . -12,-35,-23,58 B. -12,-35,58,-23 C. -23,-35,-12,58 D. -35,-23,-12,58 Mahi has 31 rolls of string. Each roll holds 12 yards of string. How many feet of string does she have? can anyone tell me my mistakes pls? Help me pleas I need help to solv this problem