Ellen is drawing two polygons. One of the polygons has 3 more angels then the other. What shapes could she be drawing?

Answers

Answer 1

Answer:

Step-by-step explanation:

This is quite and easy one, but also vague at the same time.

A polygon is a shape with 5 or more sides, so, if she were drawing a pentagon, then the second polygon has to be an octagon. A pentagon has 5 sides, and an octagon has 5 + 3 sides

In the same vein, if she were drawing a hexagon, with 6 sides, the other polygon has to be monsoon, with 6 + 3 sides.

A heptagon also gives us a 7 + 3 polygon, in decagon.

All in all, it depends on the first polygon she's drawing as the question is vague in that aspect.


Related Questions

PLSSSSSSSSS HELPP WILL GIVE BRAINLIEST PLSSS

Answers

Answer:

Probably the median since it is 22

Step-by-step explanation:

Mrs. Leary wants to buy some plants and potting soil. Each plant costs $2.50 and each bag of potting soil costs $3.25. Mrs. Leary wants to spend no more than $50. If Mrs. Leary buys 4 bags of potting soil, which inequality represents the number of plants, p, that she may buy?

Answers

Answer: Ok while i was working out this problem I started by multiplying so i started by 5

2.50 x 5 = 12.5

3.25 x 5 = 16.25 then I added then and got 28.75. So i was like i should go higher. I picked 7.

2.50 x 7 = 17.5

3.25 x 7 = 22. 75 then I added those two and got 40.25 when i got that I was like yes, Im getting closer. So i picked 9 then I got..

2.50 x 9 = 22.5

3.25 x 9 = 29.25 and that equaled 51.75

so then i was like oh! Taxes so I think the answer might be 8. 46 plus tax lol.

Step-by-step explanation:

what is the value of x??
−3(x+9)=33

Answers

Answer:

x= −20

Step-by-step explanation:

Let's solve your equation step-by-step.

−3(x+9)=33

Step 1: Simplify both sides of the equation.

−3(x+9)=33

(−3)(x)+(−3)(9)=33(Distribute)

−3x+−27=33

−3x−27=33

Step 2: Add 27 to both sides.

−3x−27+27=33+27

−3x=60

Step 3: Divide both sides by -3.

−3x −3 = 60 −3 x=−20

Answer:

x=−20

Hope this helps! :)

Answer:

x=-20

Step-by-step explanation:

−3(x+9)=33

Divide both sides by -3

-3(x+9)/-3=33/-3

simplify;

-3(x+9)/-3

Divide the numbers:3/3=1

=x+9

Simplify 33/-3

=-33/3

Divide the numbers 33/3

=-11

x+9=-11

Subtract 9 from both sides

x+9-9=-11-9

Simplify;

x=-20

Helped by none other than the ONE and ONLY #QUEEN aka #DRIPPQUEENMO!

Also I need part b on this one

Answers

Answer:

there is nothing here but thanks for the points

Step-by-step explanation:

Have a great rest of your day/night!

pls help meeeeeeeeeeeeeee

Answers

Answer:

73

Step-by-step explanation:

13+15(4) = 73

it is c, 73. all you do is plug 4 in for x then multiply and add

Help me pleaseee!! I’ll mark

Answers

Answer:

esarespuesta  ad 56

Step-by-step explanation:

Answer: Linear

Explanation: y =-5x -3

yall i need help rn please

Answers

Answer:

D

Step-by-step explanation:

Answer:

D

Step-by-step explanation:

If y = 1/2x, then y will always be half of x.

A second linear function, y = mx + 4, has the same slope as the
function in the table. What is the value of m?

Answers

Answer:

Step-by-step explanation:

How much tax, in dollars, did Andrea pay for each song? There are 85 songs, each one costs 1.09 plus tax, and the total is $96.90

Answers

Answer:

$4.25 tax

Step-by-step explanation:

[tex]85 \times 1.09 + x = 96.90[/tex]

[tex]x = 4.25[/tex]

The United States Postal Service delivers about 2^8⋅5^2 pieces of mail each second. There are 2^8⋅3^4⋅5^2 seconds in 6 days. How many pieces of mail does the United States Postal Service deliver in 6 days? Write your answer as an expression involving three powers.

Answers

Answer:

The total number of pieces delivered in 6 days is the number delivered each second (28.52) times the number of seconds in 6 days (28 34.52). This gives:

(28.52) (28 3¹.52) 28 + 8.31.52+2 = 216.31.54

I love your profile picture and I hope this helps! :)

HELP ME PLEASE I NEED THE ANSWERS ASAP. geometry

Answers

Answer:

[tex]6\pi[/tex], 6pi

Step-by-step explanation:

The area of the full circle would be [tex]\pi *4^{2}[/tex], which is [tex]16\pi[/tex]

A full circle is 360 degrees. Since we are only taking a part of that, 135, we would put it in a fraction. [tex]\frac{135}{360}[/tex]

Last, multiply 16pi and 135/360 since we are taking a part of 16pi.

[tex]16\pi *\frac{135}{360}[/tex]

[tex]\frac{2160\pi}{360}[/tex]

[tex]6\pi[/tex]

Suppose Lindsay’s mom invests $10,000, part at 3%, and the rest at 2.5%, in interest-bearing accounts.-10,00007.5 The totally yearly investment income (interest) is $283. How much did Lindsay’s mom invest at each rate?

Answers

Answer:

she invested 6600 at 3% and 3400 at 2.5%

Step-by-step explanation:

Simple interest = amount deposited x time x interest rate

Let the amount deposited in in the account bearing 3% interest by represented with a

Let the amount deposited in in the account bearing 2.5% interest by represented with (10,000 - a)

a x 0.03 + (10,000 - a) x 0.025 = 283

0.03a + 250 - 0,025a = 283

collect like terms

0.03a - 0.025a = 283 - 250

0.005a = 33

a = 6600

the amount deposited in the 2.5% account = 1000 - 6600 = 3400

If a point is randomly selected from the area under the curve, what is the probability that it will be in the black region?
A) 0.5
B) 1.0
C) 1.5
D) 2.0

Answers

Answer:

A) 0.5

Step-by-step explanation:

The probability between 0 and 3 is 0.49865

The probability of 0 or less (≤ 0) is 0.50000

Took the test on USA Test prep

The average weight for three children was 79.6 pounds. What was the sum of their
weight?

Answers

Answer: 238.8

Step-by-step explanation:

To get an average, you add the weights together, the sum. And then you divide by how many children there was.

To go backwards, you'd times the average by the amount of children there were, 3, to get the sum

79.6 times 3 is 238.8

Write the function in the form f(x) = (x − k)q(x) + r for the given value of k. F(x) = x3 − x2 − 18x + 19, k = 4 f(x) = Demonstrate that f(k) = r. F(4) =

Answers

Solution :

Given :

[tex]$f(x)=x^3-x^2-18x+19$[/tex]

By using the remainder theorem, if f(x) is divided by (x-k) and the remainder is 'r', then

[tex]$f(x)=(x-k)q(x)+r$[/tex]

Here, k = 4

Therefore, divide the f(x) with (x - 4) to find the q(x) and r.

           __________________

[tex]$x-4$[/tex]    |    [tex]$x^3-x^2-18x+19$[/tex]         |      [tex]$x^2+3x-6$[/tex]

            [tex]$x^3-4x^2$[/tex]

         ------------------------------------

                    [tex]$3x^2-18x$[/tex]

                    [tex]$3x^2-12x$[/tex]

          -------------------------------------

                          [tex]$-6x+19$[/tex]

                          [tex]$-6x+24$[/tex]

          -------------------------------------

                                  [tex]$-5$[/tex]

Therefore,

q(x) =  [tex]$x^2+3x-6$[/tex]

  r = -5

[tex]$f(x)=(x-4)(x^2+3x-6)-5$[/tex]

[tex]$f(4)=(4-4)(4^2+3 \times 4-6)-5$[/tex]

       [tex]$=-5$[/tex]

A 68 kg deer has a momentum of 952 kg-m/s. What is its velocity?

Answers

Answer:

14 m/s

Step-by-step explanation:

The points with coordinates (0, 3) and (8, 5) lie on the straight line L. Write down an equation of L.

Answers

Answer:

y = (1/4)*x + 3

Step-by-step explanation:

A linear equation can be written as:

y = a*x + b

Where a is the slope, and b is the y-intercept.

If the line passes through the points (x₁, y₁) and (x₂, y₂) the slope can be written as:

a = (y₂ - y₁)/(x₂ - x₁)

In this case, we know that the line passes through the points (0, 3) and (8, 5)

Then the slope will be:

a = (5 - 3)/(8 - 0) = 2/8 = 1/4

Then this line is something like:

y = (1/4)*x + b

Now we want to find the value of b.

Here we can use one of the two points that we know, for example, I will use the point (0, 3), this means that when x = 0, we must have y = 3.

If we replace those two values in the line equation, we get:

3 = (1/4)*0 + b

3 = b

Then the equation for the line L is:

y = (1/4)*x + 3

What is the 15th term in the sequence with the given formula?
An = 7n – 10

Answers

15th term :
7.15-10 = 105-10 = 95 good luck

Question 3 of 10
What is the formula for finding the break-even point?
A. Break even point =
(0.125)(# of points)
monthly savings
B. Break even point =
(0.01)(# of points) (P)
monthly savings
C. Break even point =
(0.125)(# of points) (P)
monthly savings
D. Break even point =
(0.01) (# of points)
monthly savings
SUB

Answers

Answer: B. Break even point=(0.01)(# of points)(P) / monthly savings

Step-by-step explanation: took the quiz.

The formula for finding the break-even point is: Break-even point = Fixed costs ÷ (Unit price - Variable costs per unit).

What is break-even point?

The break-even point is the point at which a company's total revenue from sales equals its total costs, resulting in a profit of zero. There is no profit or loss at the break-even point.

The formula for finding the break-even point is:

Break-even point = Fixed costs ÷ (Unit price - Variable costs per unit)

Where:

Fixed costs: the costs that do not change with the level of production or salesUnit price: the selling price of one unit of the product or serviceVariable costs per unit: the costs that vary with the level of production or sales, such as materials, labor, and shipping costs.

Thus, the break-even point is the point at which the total revenue from sales equals the total costs, so there is neither a profit nor a loss.

For more details regarding break-even point, visit:

https://brainly.com/question/29063970

#SPJ5

please help me thank you
i have 2MINUTES LEFTT

Answers

Answer:

55°

Step-by-step explanation:

2 is congruent with 1

Water is being drained from a swimming pool containing 12,000 gallons of water. After
one hour passes, 60% of the water remains. At the start of the fifth hour, how many
gallons of water remain? Round your final answer to the nearest gallon.
933 gallons
560 gallons
1.555 gallons
2,592 gallons

Answers

560 callate your head

85 - 3x = 40
solve the inequality

Answers

-3x=40-85
-3x=-45
x=15

Answer:

x=15

Step-by-step explanation:

Like solving all Algebra equations, it is very important to make sure that the variables (In this case x) are on one side and the numbers are on the other side.

85-3x=40

First, let's subtract 40 on both sides

45-3x=0

Add 3x to both sides

45=3x

Let's divide both side by 3

And we get...

x=15

Need help What is 6/10 in simplest form

Answers

Answer:

3/5

Step-by-step explanation:

35.

Step-by-step explanation:

The simplest form of 610 is 35.

1) Mary and Frank have two bags in front of them. Mary's bag has 4 Inarbles; blue, yellow, red
and green. Frank's bag has 3 marbles; purple, orange, and pink. They will pick from their bag
at the same time. What is the probability of Mary selecting red from her bag and Frank selecting
purple from his bag? Use a sample space to support your answer.

Answers

Answer:

25% chance that Mary gets red, 33.3333333% chance that Frank gets purple.

Step-by-step explanation:

Please help! If you do you get 'Brainliest'

Answers

Answer:

D

Step-by-step explanation:

when dealing with percentages move the decimal back two to get its absolute value

Why does everyone expect people to awnser questions but they never awnser any them selves like I need help and I've helped loads of people with their questions but not even a single one of my questions are awnsered people just want fee points so they pick easy questions not cool

Answers

Answer:

thats crazy bro

Step-by-step explanation:

Answer:

This is very true

Step-by-step explanation:

I know how you feel

A law firm is going to designate associates and partners to a big new case. The daily rate charged to the client for each associate is $700 and the daily rate for each partner is $1700. The law firm assigned 4 more partners than associates to the case and was able to charge the client $21200 per day for these lawyers' services. Write a system of equations that could be used to determine the number of associates assigned to the case and the number of partners assigned to the case. Define the variables that you use to write the system

Answers

the sun is one hundred and fifty million kilometers away from the earth write this as an ordinary whole number

12 donuts cost $6.96. What is the unit rate for one donut?

Answers

Answer:

6.96/12

= 0.58

Step-by-step explanation:

each donut costs $0.58. you can check the work by plugging 12 in for x.  (0.58x)

i hope this helps :)

Convert: 5 mi= ________ yd
Group of answer choices

1,760

8,800

8,000

7,040

The ___________________ of an object is how heavy the object is
Group of answer choices

none

length

weight

capacity

The _____________________ of a container is the amount the container can hold.
Group of answer choices

length

capacity

No answer text provided.

weight

A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
__________________________________________________________
__________________________________________________________

Convert: 9 T = _____________ lb =

Compare. Write <, > or = Solve.

96 fl oz ___________ 13 c

Compare. Write <, > or = Solve.

25 lb ______________ 384 oz


Compare. Write <, > or = Solve.

8 yd ______________ 288 in.


Convert. 336 oz = _________ lb =

Answers

Answer:

I DONT KNOW BUT

Step-by-step explanation:

can somebody help quick

Answers

Answer:

1.5x + 14

Step-by-step explanation:

Answer:

3x+28

Step-by-step explanation:

Other Questions
A 9-inch diameter pizza has 30 calories per square inch. About how many calories are in the entire pizza?Use 3.14 for pi. Amelia is using substitution to determine if 8 is a solution to the equation. Complete the statements. 6a = 42 for a = 8 First, Amelia must substitute 8 for the using To simplify, Amelia must 8 a solution of the equation. pls hurry I'm on timer what were the social achievements of rana regime? HELP ME PLS! ASAP 10 POINTS FOR THIS ONE & THE NEXT ONE!!!!!! can someone please help me What was Kristallnacht? a. an attack on Jewish homes, businesses, and synagogues in Germany b. a ship full of Jewish refugees denied entry in the United States c. a set of laws denying Jews of their German citizenship, jobs, and property d. a group of highly educated Jewish refugees allowed into the United States Find the circumference and area of a circle A with a diameter of 26 inches. Please I need the answer ASAP. Thank you very much. where did Jewish immigrants to South africa come from what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? Did I do this right? if I didn't get it right can you help me? Thank you! Determine which number is a solution to the inequality. These four numbers are plotted on a number line:-23,58,-35,-12Which is the correct ordering on the number line, from left to right? A . -12,-35,-23,58 B. -12,-35,58,-23 C. -23,-35,-12,58 D. -35,-23,-12,58 Mahi has 31 rolls of string. Each roll holds 12 yards of string. How many feet of string does she have? can anyone tell me my mistakes pls? Help me pleas I need help to solv this problem please help worth 20 points Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Please help I need this done!Will give the brainliest! how many cm are in 84.363 km Why was Winston Churchill opposed to Neville chamberlain signing the Munich pact ?