Can someone Plz give me skin in fornite I'm poor and I have no battle pass no v bucks like 0 and I just want one plz my user is Emily_mari90 again Emily_mari90

Answers

Answer 1

Answer: Fort nite sorry when i think of fort nite i think reekid lol

Explanation:


Related Questions

1.Assinale a oração em que o termo destacado seja um adjetivo: *

Mas que pernas ! Nunca tinha
reparado na feiura das minhas pernas.

b) “[...] uma alcateia de ferozes foi chegando e espalhou o bando, que correu assustado.”.

c) “O alce para a mata e perdeu-se do bando.”.

d) “No caminho, o chifre numa árvore e quase foi devorado pelo lobo.”.

Answers

It’s gone b b because there is no other reason

Suppose two drugs are routinely used for the treatment of thyroid dysfunction. Drug X is known to cure the disorder 75% of the time and costs $88.
Drug Y is known to cure the disorder 60% of the time and costs $75. The two drugs work independent of each other. The two treatment plans are as
follows:
Plan A: Treatment with Drug X-if not effective treatment with Drug Y
Plan B: Treatment with Drug Yếif not effective, treatment with Drug X
28
Select the correct answer.
From the perspective of an insurance company paying for the treatment, which is the best decision?
ОА.
Based on the overall probability of a cure, plan A should be selected over plan B.
ОВ.
Based on the overall probability of a cure, plan B should be selected over plan A.
OC. Based on the overall cost of treatment plan A should be selected over plan B.
OD
Based on the overall cost of treatment plan B should be selected over plan A.

Answers

Answer:

The correct answer is A)

Explanation:

This is because the chances that the company will prevent additional expenses on the treatment of the ailment is 75% which is higher than that of the other drug whose effectiveness is at best 40% less than the expected results and 15% reduced than drug A.

In other words, if the drug b is used first, there is an increased chance that the company will spend more money to treat the ailment.

Cheers

a is a short document that briefly outlines qualifications abillities and accomplishments

Answers

Answer:

Curriculum vitae (resume).

Explanation:

Certification can be defined as a recognition given for completing a course of study or passing an examination. This is to certify that the individual is a professional in that course of study. Some examples are CCNA, Comptia A+, HSE I and II, degree certificates, etc.

A Bachelor's degree refers to an academic degree (certificate) awarded to a student by a tertiary institution (university or college) after the completion of his or her educational programme. Bachelor's degree is generally being referred to as first degree because it is the first certification to be acquired by an undergraduate student after the completion of his or her course of study. Mostly, a bachelor’s degree program lasts for four (4) years and in some cases it is typically for five (5) years.

The second (next) degree a graduate obtains after the acquisition of a first degree (bachelor degree) is the master's degree. The advantage of a master degree is that, it can be obtained in a different academic field such as science, engineering, education etc.

A curriculum vitae (resume) is a short document that briefly outlines qualifications, abillities and accomplishments of a person, haven completed and obtained an academic certificate.

Generally, all job applicants are required to have a curriculum vitae (resume). This document is always requested by human resource managers during the job application process. Thus, all applicants must attach it to their written application letter because it's a profile summary of the necessary information needed for a particular job.

Fun Fact


Frogs buttholes are water tight

Answers

Answer:

amazing!

Explanation:

1 ).Which religion celebrates christmas easter and pentecost?
A) christianity
B) judaism
C)hinduism
D)islam

2). belief in a set of principles that guide ones life is
A)ethiclism
B) animism
C). polytheism
D). monotheism

Answers

Answer:

Q1

A) Christianity

Q2

A) Ethiclism

In economics, products are classified into which two categories?

Answers

Answer:

consumer products and industrial products

Answer: Classification of Products – 2 Important Categories: Consumer Products and Industrial Products. ADVERTISEMENTS: Broadly speaking, products are divided into two categories – consumer and industrial products.

Question :
what are dreams?​

Answers

Answer:

although scientist aren't exactly sure why we dream, most believe that dreaming is the brains way of keeping it entertained while we sleep

Answer: What your mind thinks/processes of the thoughts your thinking and/or have thought of.

Explanation:

Which expression is equivalent to 6x-9/3​

Answers

Answer:-18

Explanation:

Answer:

its b

Explanation:

i took the quiz

A scientist is studying the average speed and fastest recorded speed of four creatures. His results, in miles per hour, are shown in the table below.

For which creature is the difference between average speed and fastest speed the greatest?


Werewolf
Phoenix
Mermaid
Centaur
They are all the same.

Answers

where are the results?

When Billy's asked how old he is, he replies, "In two years i will be twice as old as i was 5 years ago." How old is he?

Answers

12 years old using the following work

12 years old.

• Let the present age of Billy be represented by x.

• In two years, Billy will be: = x + 2

• Since in 2 years, he will be twice as old as he was 5 years ago, this will be:

x + 2 = 2(x - 5)

The equation to solve the question is:

x + 2 = 2(x - 5)

x + 2 = 2x- 10

Collect like terms

2x - x = 2 + 10

x = 12

• Billy is 12 years old.

One of the legs of a right triangle measures 2 cm and its hypotenuse measures 9 cm. Find the measure of the other leg. If necessary, round to the nearest tenth.

Answers

Answer:

The measure of the other leg = 8.8 cm

Explanation:

Given - One of the legs of a right triangle measures 2 cm and its hypotenuse measures 9 cm.

To find - Find the measure of the other leg.

Proof -

We know that,

For a right angle triangle,

Apply The Pythagoras Theorem , which states that

(Hypotenuse)² = (Base)² + (Perpendicular)²

Given that,

Hypotenuse =  9 cm

One leg = 2 cm

Let us assume that,

One leg is base and another leg is Perpendicular.

We also can suppose vice-verse, it does not affect the solution.

Now,

(Hypotenuse)² = (Base)² + (Perpendicular)²

⇒(9)² = (2)² + (Perpendicular)²

⇒81 = 4 + (Perpendicular)²

⇒81 - 4 = (Perpendicular)²

⇒77 = (Perpendicular)²

⇒√77 = Perpendicular

⇒Perpendicular = 8.775 ≈ 8.8

∴ we get

The measure of the other leg = 8.8 cm

Other Questions
can someone please help me What was Kristallnacht? a. an attack on Jewish homes, businesses, and synagogues in Germany b. a ship full of Jewish refugees denied entry in the United States c. a set of laws denying Jews of their German citizenship, jobs, and property d. a group of highly educated Jewish refugees allowed into the United States Find the circumference and area of a circle A with a diameter of 26 inches. Please I need the answer ASAP. Thank you very much. where did Jewish immigrants to South africa come from what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? Did I do this right? if I didn't get it right can you help me? Thank you! Determine which number is a solution to the inequality. These four numbers are plotted on a number line:-23,58,-35,-12Which is the correct ordering on the number line, from left to right? A . -12,-35,-23,58 B. -12,-35,58,-23 C. -23,-35,-12,58 D. -35,-23,-12,58 Mahi has 31 rolls of string. Each roll holds 12 yards of string. How many feet of string does she have? can anyone tell me my mistakes pls? Help me pleas I need help to solv this problem please help worth 20 points Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Please help I need this done!Will give the brainliest! how many cm are in 84.363 km Why was Winston Churchill opposed to Neville chamberlain signing the Munich pact ? Many Americans are continuing to work well into their 60s and beyond. About 20% of America's workforce is made up of people who are 55 years old or older. Instead of not working during their golden years, people are choosing to stay employed. Some still work because they want to remain active and productive. Others still work because they need the income. Whatever the reason, many government agencies predict that the number of older people in the workforce will continue to grow.Based on the passage, what does the euphemism golden years mean? A. generation B. old age C. existence D. early life It take 38.70cm of 1.90 NaO4 to neutralize 10.30cm of H2So4 in a battery. Calculate the molar concentration of H2So4 What are the dimensions of this matrix?7 8 6 3 You are on a road trip and have driven 24 miles, which is 3/4 of the total distance.What is the total distance of this trip?