Arsenic is an element that occurs naturally in groundwater, but a mean greater than 8.0 parts per billion indicates that the groundwater has been contaminated. Local officials are concerned about a well in an area of the city near a factory. On 50 consecutive days, water was randomly sampled from the well. Assume the water in the well has a mean arsenic level greater than 8.0 ppb. Based on the data, if we find moderate/strong evidence against the null hypothesis and conclude the mean arsenic level of the water is greater than 8.0 ppb, we have made ____________.

Answers

Answer 1

Answer:

Based on the data, if we find moderate/strong evidence against the null hypothesis and conclude the mean arsenic level of the water is greater than 8.0 ppb, we have made ____________.

a correct decision.

Step-by-step explanation:

Since there is enough evidence to conclude that the mean level of arsenic is greater than 8.0 ppb, the correct decision has been made.  There is no type I or type II error.   The type I error (called a false positive) occurs if we reject the null hypothesis when it is true.   Since we have simply rejected the null hypothesis when the alternate hypothesis is true, and the null hypothesis should be rejected, a correct decision has been made.

Answer 2

Answer:

decision

Step-by-step explanation:

Based on the data, if we find moderate/strong evidence against the null hypothesis and conclude the mean arsenic level of the water is greater than 8.0 ppb, we have made decision


Related Questions

Help me please!!! Fasttt 75 points.
Solve.....

Answers

Answer:

-11/12

Step-by-step explanation:

Which represents the solution set of 5(x+5) <85?
x <12
X> 12
x<16
x> 16

Answers

x < 12 represents the solution set

Simplified Equation:

5x+25<85

Answer:

x<12

An initial amount of money is placed in an account at an interest rate of 3% per year, compounded continuously. After six years, there is $1819.77 in the account. Find the initial amount placed in the account. Round your answer to the nearest cent.

Answers

Hi

Let's call X  the amount in the beginning.  

we  have X*1.03^6 = 1819.77

                X =  1819.77 /  1.03^6

                X ≈ 1524.03

What is the surface area in square centimeters of the figure shown below?
11 cm
6 cm
4 cm

Answers

Answer:

268 cm²

Step-by-step explanation:

Surface area = (front + back + left side + right side + top + bottom) areas

since pairs of areas are the same (front back, left rigth, top bottom)

Surface area = (2 · front + 2 · left side  +  2· top) areas

                     = 2 · 11 · 4 + 2 · 11 · 6 + 2 · 4 · 6

                     = 268 cm²

RENAME 11/12 / 8/9 AS A MIXED NUMBER

Answers

Answer: 1(29)/(36)

Step-by-step explanation:

1/2 to the power of 3

Answers

0.125 or 1/8
hopes it helps you

Male Color Blindness
Approximately 9% of men have a type of color blindness that prevents them from
distinguishing between red and green. If 3 men are selected at random, find the
probability that all of them will have this type of red-green color blindness.​

Answers

Answer:

About 0,3? Could go higher but the middle answer ( highest probability) is correct to me.

Step-by-step explanation:

Please help me

X*1+ x/1

Pick one of these
x
1
2x
1+x

Answers

Answer:

2x

Step-by-step explanation:

x*1 is x

x/1 is also x

x+x=2x

A:12 B:11 C:15 D:16. I need help

Answers

Answer:

B

Step-by-step explanation:

B is the only option between 0, 10 and 12, 1

I this it is d your welcome

Find the area of the following
trapezoid:
8 cm
5 cm
4 cm
16 cm
A = [?] cm2
PLEASE HELP

Answers

Answer:

48 cm²

Step-by-step explanation:

Area of trapezoid = [tex]\frac{a + b}{2}[/tex] × h

Area = (8 + 16)/2 x 4

Area = 24/2 x 4

Area = 12 x 4

Area = 48 cm²

A survey of Mrs. Ramirez's students showed that 30
students will have pizza fonlunch, 17 will have macaroni
and cheese, 12 will have a hamburger, and 5 will have
chicken fingers. Suppose Mrs. Ramirez surveys all 1 200
students in the school. How many students can she
expect to choose hamburgers for
Hunch?

Answers

Answer: 480

Step-by-step explanation:

We can create a ratio for this!

We have:

[tex]\frac{number of hamburgers}{total students}[/tex]= [tex]\frac{new number of hamburgers}{new number of students}[/tex]

We can use substitution to input the information we already know:

[tex]\frac{12}{30}[/tex] = [tex]\frac{x}{1200}[/tex]

Using cross multiplication, we get:

1 200(12) = 30x

14,400 = 30x

[tex]\frac{14,400}{30}[/tex]=[tex]\frac{30x}{30}[/tex]

x = 480

Hope this helps! :)

The number of students expect to have hamburgers for lunch is 225 students.

What is a word problem?

A word problem is a verbal description of a problem situation. It consists of few sentences describing a 'real-life' scenario where a problem needs to be solved by way of a mathematical calculation.

For the given situation,

Mrs. Ramirez's survey on students

Number of students have pizza = 30

Number of students have macaroni and cheese = 17

Number of students have a hamburger = 12

Number of students have chicken fingers = 5

Total number of students = 64.

Now, Mrs. Ramirez surveys all 1 200 students.

Then number of students expect to choose hamburgers for lunch can be found by,

[tex]\frac{Number of students have hamburgers}{Total number of students} = \frac{Number of students expect to have hamburgers}{ Total number of students}[/tex]

Let x be the number of students expect to have hamburgers.

⇒ [tex]\frac{12}{64}=\frac{x}{1200}[/tex]

⇒ [tex]x=\frac{(12)(1200)}{64}[/tex]

⇒ [tex]x=225[/tex]

Hence we can conclude that the number of students expect to have hamburgers for lunch is 225 students.

Learn more about word problems here

brainly.com/question/20594903

#SPJ2

21.79 + x = 25


make sure to do a explanation

Answers

Answer:

x= 3.21

Step-by-step explanation:

25- 21.79= 3.21

the equation equals to 25 so you need to find what x is by subtracting the other value

Hope this helps

help me......................

Answers

Answer:

a

Step-by-step explanation:

A shoe box has a volume of 693 cubic inches. The area of the base of the shoe box is 126 square inches. What is the height of the shoe box in inches?

Answers

Answer: 5.5

volume formula:

v = bh

693 = 126h

h = 5.5

Help! Will give Brainliest

Answers

Answer:

B

..................... ....

what is the distance between -8 and 535 on a number line

Answers

Answer:

527

Step-by-step explanation:

because i did it in the calculator

I NEED THIS DONE NOW I'VE BEEN ON IT ALL DAY

Answers

Q5 is 115. Hope this helps! :) ✨

I can't see the numbers on Q6 sorry :((

PEMDAS Which one in the equation goes first?

Answers

Answer:

A

Step-by-step explanation:

A because the first letter in PEMDAS is P, which is parenthesis.

Answer:

The Parenthesis

Step-by-step explanation:

these (    )

I need help DONT scam me with a link or I report

Answers

Answer:

9 blue

Step-by-step explanation:

It said 3 blue and 4 white

but Jade put 12 white and to get 12 from 4 you need to multiply 4 by 3

so you would also need to do the same for blue, 3 x 3 = 9

Answer:

how do you report sombody

Step-by-step explanation:

an object is launched at 4 ft./s from 88 foot tall platform the objects height H in feet after T seconds is given by the equation H=-16T^2+8t+80 when does the object strike the ground

Answers

Answer:

1.5seconds

Step-by-step explanation:

When the ball hits the ground, the height is equal to zero. So find t when H=0:

H=16t²+8t+80

0=16t²+8t+80

0=2t²+t+10

0=(2t-3)(t+2)

So (2t-3)=0, or (t+2)=0

So t=1.5 or t=-2. Time can't be negative though, so we take our answer as 1.5seconds

An architect is allowed 56 square yards of floor space to add a small bedroom to a house. because of the rooms design in relation to the existing structure, the lenght of the rectangular floor must be 6 yards less than 2 Times the width.Find the lenght and width of the rectangular floor that the architect is permitted

Answers

there would be 5 rooms because

Use the figure below to answer the question. What is the measure of ∠ABC? *

Answers

Answer:

D 98°

Step-by-step explanation:

180-82 = 98 or the long way

3x+5 = 180-82

3x = 93

x = 31

3(31) + 5 = 98

In a triangle, the sum of the lengths of the
two shorter sides is 13 inches. What do
you know about the length of the third
side?

Answers

Answer:

The length of the third side is less than 13.

Step-by-step explanation:

In any given triangle the sum of any two sides is longer than the length of the third side.

This means that the length of the third side has to be less than 13, since that is the sum of the lengths of the two shorter sides.

23. -2/k=?/8k?
Need the answer ASAP please.

Answers

Answer:

-1.44859461 × 1023 m-2 kg-1 s2 K

Solve the following equation: 8x + 6 + 3x - 4
Please hurry.

Answers

Answer:

A

Step-by-step explanation:

x = -2

Answer:

x=-2

Step-by-step explanation:

I would put steps, but it sounds like your in a hurry, so there is the answer, if you want, I can put the steps in the comments

But yeah

If that helps, plz mark brainiest, i'm almost leveled up :3

Thanks!

What can you say about the end behavior of the function f(x) = -4x6+6x2 -52 ?
A. F(x)is an even function so both ends of the graph go in the same
direction.
B. f(x) is an even function so both ends of the graph go in opposite
directions
O C. The leading coefficient is negative so the left end of the graph
goes up.
D. The leading coefficient is negative so the left end of the graph
goes down

Answers

Answer:

A. F(x)is an even function so both ends of the graph go in the same direction.

D. The leading coefficient is negative so the left end of the graph goes down.

Step-by-step explanation:

Even function:

For every value of x, f(x) = f(-x)

In this question:

We are given the following function:

[tex]f(x) = -4x^6 + 6x^2 - 52[/tex]

Testing if it is even:

[tex]f(1) = -4(1)^6 + 6(1)^2 - 52 = -4 + 6 - 52 = -50[/tex]

[tex]f(-1) = -4(-1)^6 + 6(-1)^2 - 52 = -4 + 6 - 52 = -50[/tex]

Since f(1) = f(-1), it is even.

Since it is even, both ends of the graph go in the same direction, so option A is correct, while option B is wrong.

Options C and D:

The leading coefficient, is -4(which multiplies x with the highest exponent). Since it is negative, it goes to negative infinity as x increases, that is, the left end goes down, and option D is correct while C is not.

A group of students must collect at least 5120 to organize a science fair. They have already collected $40. Which graph best represents the possible amounts of money the
students still need to collect
HHH
++
.
20 40
60
1000 14001
+++
++
20 40
600 100 120 5401600
AHH
206000 470018

Answers

Answer:i believe its c

Step-by-step explanation:its the only graph that starts on 40

Given that A'B'C' is the image of ABC under a reflection, enter that equation of the line of reflection.

Answers

Answer:

sooooo

Step-by-step explanation:

Any tips for a gaming addicted brother? :-/

Answers

Answer:

Step-by-step explanation:

I would take his phone for a bit and also reduce screen time to 6 hours a week at MOST. It would help a lot.

Given = x= [b a 4 a ] Y =[c d a b] and z = [a c 16 b] What is Y if x-2y=Z?​

Answers

Answer:

a  [2, -4, -6, -2]

Step-by-step explanation:

The calculated value of the matrix Y is : Y = [tex]\left[\begin{array}{ccc}2&-4\\-2&-6\end{array}\right][/tex]

What is matrix?

In mathematics, a matrix is a rectangular array or table of numbers, symbols, or expressions, arranged in rows and columns, which is used to represent a mathematical object or a property of such an object.

Here, we have,

Calculating the matrix Y

From the question, we have the following parameters that can be used in our computation:

Given that

X - 2Y = Z

So, we have

b - 2c = a

a - 2d = c

4 - 2a = 16

a - 2b = b

So, we have

4 - 2a = 16

-2a = 12

a = -6

Next, we have

a - 2b = b

-6 - 2b = b

3b = -6

b = -2

Next, we have

b - 2c = a

-2 - 2c = -6

-2c = -4

c = 2

Lastly. we have

a - 2d = c

-6 - 2d = 2

-2d = 8

d = -4

The matrix Y is given as: Y =[c d a b]

So, we have

Y = [tex]\left[\begin{array}{ccc}2&-4\\-2&-6\end{array}\right][/tex]

Read more about matrix at

brainly.com/question/11989522

#SPJ2

Other Questions
the winner of a raffle will receive a 21-foot outboard boat. if 2000 raffle tickets were sold and you purchased 50 tickets, what are the odds against your winning boat? Que es una campaa?, que proposito puede tener?, porque medios se puede tranmitir?, que recursos del lenguaje se pueden utilizar en ella? help in pic eeeeeeee Use Trig to Solve this...If you dont know how to use trig in right triangles then DONT answer. A steel bottle contains nitrogen gas at STP. What is the final pressure if the temperature is changed to 155C? Calculate the number of moles in 40g of Al(OH)3 a example of metaphor and explain the metaphor Write a scientific explanation as to What is the main cause of global warming?" What is the relationship between Nike with the Second Industrial Revolution? Which expression is equivalent to 7x(yz - 7 - 2y) A 9-inch diameter pizza has 30 calories per square inch. About how many calories are in the entire pizza?Use 3.14 for pi. Amelia is using substitution to determine if 8 is a solution to the equation. Complete the statements. 6a = 42 for a = 8 First, Amelia must substitute 8 for the using To simplify, Amelia must 8 a solution of the equation. pls hurry I'm on timer what were the social achievements of rana regime? HELP ME PLS! ASAP 10 POINTS FOR THIS ONE & THE NEXT ONE!!!!!! can someone please help me What was Kristallnacht? a. an attack on Jewish homes, businesses, and synagogues in Germany b. a ship full of Jewish refugees denied entry in the United States c. a set of laws denying Jews of their German citizenship, jobs, and property d. a group of highly educated Jewish refugees allowed into the United States Find the circumference and area of a circle A with a diameter of 26 inches. Please I need the answer ASAP. Thank you very much. where did Jewish immigrants to South africa come from what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? Did I do this right? if I didn't get it right can you help me? Thank you!