2. What is the function of the cell membrane in cell division?

Answers

Answer 1

Answer: the main function is to control what goes in and out of the cell. It is made of a double layer of lipids (fats) imbedded with odd-looking protein molecules. Because it is a fat, only some things that are very tiny, like water and oxygen pass through this part.

Explanation:


Related Questions

The male rabbit's genotype is __________ and the female rabbit's genotype is __________

Answers

Answer:

male is XY female is XX

Explanation:

Male = XY forgot what female is lol

Organisms that are better able to survive are more likely to _______ and pass on their traits.

Answers

Answer: make

Explanation:

¿Pueden los icebergs ser considerados como
un tipo de glaciar?

Answers

Answer:

La diferencia entre un iceberg y un glaciar es que el iceberg es la pieza de un glaciar que se desprende (o se rompe) cuando las temperaturas suben. Los glaciares están formados por una gran masa de mezcla de nieve y hielo que cubre el fondo del valle de una cadena montañosa.

Explanation:

Help if you can no links please
What happens at a cell cycle checkpoint?

Answers

Answer:

If the checkpoint mechanisms detect problems with the DNA, the cell cycle is halted, and the cell attempts to either complete DNA replication or repair the damaged DNA. If the damage is irreparable, the cell may undergo apoptosis, or programmed cell death 2.

Explanation:

true or false
A niche includes just the biotic parts of an environment

Answers

Answer: Im pretty sure its true

Explanation:

An organisms niche includes its environment, behaviors, and interactions. It also includes its role within the environment.

Test One: If I breed a short fur, FF female with a short fur, Ff male, then I will expect to see (all short fur; some short and some long fur; all long fur) offspring.

Since all these offspring only have one trait for long fur, this trait stays hidden in their DNA and is not expressed in their phenotype. All the offspring will have short fur.

Test Two: If I breed a short fur, Ff female with a short fur, Ff male, then I will expect to see (all short fur; some short and some long fur; all long fur) offspring.

Test Three: If I breed a long fur, ff female with a long fur, ff male, then I will expect to see (all short fur; some short and some long fur; all long fur) offspring.

Answers

Answer:

test two:

some short fur and some long fur will be seen.

this is because in some cases, the offsprings have only have the trait for short fur or just one trait for long fur and so short fur is expressed in the phenotype. in other cases, the offsprings have only the trait for long fur and so long fur is expressed phenotypically.

test three:

all long fur is seen.

since all the offsprings only have the trait for long fur and no trait for short fur, long fur is expressed in the phenotype.

Assuming a diallelic gene coding for the trait and expressing complete dominance, 1) all short fur. 2)some short and some long fur. 3) all long fur.

According to the information that was provided, we can assume that the trait fur length is coded by a single diallelic gene

dominant allele F codes for short fur

recessive allele f codes for long fur

We can also assume that the gene expresses complete dominance.

What is complete dominance?

It is the inheritance pattern in which the dominant allele completely masks the recessive allele.

This is the case of individuals that are heter0zyg0us for a particular gene and express the dominant phenotype. The dominant allele is hiding the expression of the recessive allele.

Many genes show complete dominance.

Cross 1:

Parentals) FF x Ff

F1) 100% short fur

All short fur

Cross 2:

Parentals) Ff x Ff

F1) 1/4 FF + 1/2 Ff / 1/4 ff

    75% short fur + 25% long fur

Some short fur, and some long fur

Cross 3:

Parentals) ff x ff

F1) 100% long fur

All long fur

Note: Due to technical problems, you will find the complete explanation in the attached files.

You can learn more about complete dominance at

https://brainly.com/question/1953851

https://brainly.com/question/16909187

https://brainly.com/question/9881046

https://brainly.com/question/13242285

PLSS HELP ME!! NO LINKS!!


*fill in the blanks*

______ formation is caused by
dripping water shaping upside down
cones from cave roofs. This is an example
of________
(weathering, erosion,
or deposition)


________ formation is caused by a small amount of minerals dripping in the dissolved water during stalactite formation. This is an example of______ (weathering, erosion, or deposition)

Plss help me:(( i will give you BRAINLYEST!!

Answers

Answer:

1 stalactite

2 deposition

3 stalagmite

4 deposition

Explanation:

Black fur (B) is dominant and white fur (b) is recessive in mice. What are the possible offspring of two black mice (Father = Bb and Mother = Bb) bred together? Think of Mendel's F2 generation.​

Answers

Answer:

BB, Bb, Bb, bb

Explanation:

by performing a punnet square you will see that these are the possible outcomes. if you need me to go into more detail I will try my best to list the genetic makeup below:

BB: 25%

Bb: 50%

bb: 25%

White: 25%

Black: 75%

How can the appearance of white baby rabbits be explained when the mother has white fur, and the father has black fur?

Answers

Explanation:

because the baby rabbit took after its mother and the

What level of organization is shown in the image​

Answers

A a gente não tem como una cena de inglês para português de inglês e

Which is true of both photosynthesis and aerobic respiration?

A. Sugars are formed
B. Both take up carbon dioxide
C. They require enzymes
D. Oxygen is a reactant
E. Oxygen is a product

Answers

Answer:

The answer is C

Explanation:

For answer A, only aerobic respiration can form sugar, photosynthesis forms ATP. Answer B, only photosynthesis takes up carbon dioxide, aerobic respiration takes up oxygen. Answer D, oxygen is a reactant only during aerobic respiration. Answer E, oxygen is only one of the product of photosynthesis, not aerobic respiration❤️

Hope this will help~Have a good day

The rate at which blood flows through the human body can change in response to multiple factors. Which statement describes one of these factors and the effect it has on blood flow?

A. The narrowing of blood vessels increases pressure and leads to faster blood flow

B. High blood viscosity increases the resistance in the blood vessels and leads to faster blood flow.

C. Low blood pH decreases the rate of diffusion through the blood vessels and leads to slower blood flow.

D. The changing of the shape of red blood cells to a crescent shape decreases resistance and leads to faster blood flow.

Explain why this is the correct answer and why the other ones are wrong:

Answers

Answer:

B

viscosity of blood causes an increased resistance in the blood vessels and

leads to slow blood flow

Explanation:

Viscosity refers to the thickness of blood. This thickness is caused by the number of red

blood cells. Thick blood travels through blood vessels at a slower rate than thin blood

Worth 26 points! Help me please! Do 1,2,3 by filling in the blank!!!! And I will make you brainest!
And don’t answer just to get points or I am reporting you

and no website

Answers

Answer:

Not to sure but try this...

1st blank try (white dots)

2nd blank try (black dots)

3rd blank try (red dots)

Hope this helps!!!

Have a good night!!!! :)

Answer:

1. Glucose

2. Glucose

3. Glucose

lol it's all the same answer I found it online

Explanation:

hope this helps ^^

El sistema nerviosos esta formado por un conjunto de fibras acordonadas, largas y delgadas, a estas se les denomina.

Answers

Answer:

fibras nerviosas

Explanation:

Los nervios están compuestos por grupos de fibras nerviosas las cuales consisten de axones y las vainas que los recubren. Una fibra nerviosa está generalmente compuesta por 1-un cilindroeje (axón), es decir, una prolongación alargada de la neurona la cual conduce el impulso nervioso (señal eléctrica), 2-el axolema, o membrana celular del axón, 3-la vaina de mielina que rodea el axón y 4-el neurilema que rodea la fibra. Las fibras nerviosas se clasifican en 1-fibras mielínicas, cubiertas por la vaina de mielina, y 2-fibras amielínicas, no recubiertas por esta vaina. La presencia de la vaina y el diámetro de la fibra influyen en la velocidad de transmisión del impulso eléctrico a través de la fibra nerviosa.

What do decomposers leave behind after getting their energy?
А
chlorophyll and vitamins
B
carbon dioxide and water molecules
C С
elements like carbon, nitrogen and phosphorus
D
energy-rich carbohydrates
Q

Answers

Answer:

Carbon and nitrogen

Explanation:

Decomposers gain energy and nutrients and energy by breaking down dead organisms and animal waste. Through that process they release nutrients. Which are carbon and nitrogen. To give nutrients to the ecosystem.

Answer:

carbon and dioxide,nitrogen and phosphorus

Explanation:

it's right 100% did the ap3x quiz

30. Which of the following best explains why enzymes are necessary for many cellular reactions?
A. Enzymes supply the oxygen necessary for the reactions.
B. Enzymes change reactants from solid to liquids during the reactions.
C. The reactions take up too much space in the cell if the enzymes are missing.
D. The reactions are too slow to meet the needs of the cell if enzymes are missing.

Answers

Answer:

D. The reaction are too slow to meet the needs of the cell if enzymes are missing

hope it helps

help-- multiple choice!
Biogenic sediment is made of at least 30 percent...

acidic chemicals

alkaline properties

limestone or other rock

skeletal remains

Answers

Answer:

The answer is the last one, skeletal remains

Answer: Skeletal remains

Explain how humans are able to produce one type of hemoglobin as they develop in utero, then produce another to use after birth

Answers

Answer:

Hemoglobin F has a different composition from the adult forms of hemoglobin, which allows it to bind (or attach to) oxygen more strongly. This way, the developing fetus is able to retrieve oxygen from the mother's bloodstream, which occurs through the placenta found in the mother's uterus.

bacteria in nodules on the roots of plants before an important role in the _______ cycle.​

Answers

Nitrogen
Not 100% sure tho

Earth's core is the source of the energy that drives the movement of tectonic plates. Which two processes help transfer this energy outward to earth's crust?

Answers

Answer:The two processes are CONDUCTION and CONVECTION

Explanation:

The Energy produced in the Earth core is generated by  Sun, gravitational force , radioactive decay, and the  Earth' rotation, To maintain balance in the earth, The  processes of CONDUCTION and CONVECTION transfer energy (HEAT) to Earth's interior, which also helps the movement of  tectonic plates at a  constant rate.

Now, inside the earth mantle is made up of hot solid rock and because Conduction occurs more in solids, Its currents helps the continuous  transfer of heat energy  from the warmer mantle at  the bottom   to  the cooler  mantle  at the top While Convection currents in the core move thermal energy causing  the rising and sinking of warm and cooler molten rock inside Earth, thereby maintaining the motion of tectonic plates and  creating a balance in the earth.

Answer:

Conduction and Convection

Explanation:

nutrients are transported to the organs of the bloodstream by which system

Answers

Answer:

The blood circulatory system delivers nutrients and oxygen.

Explanation:

What does it mean when there’s an increase of white blood cells in the body?

A) Nothing, the amount always varies
B) There is no oxygen in the body
C) Your body just finished fighting an infection
D) There is an infection in the body

Answers

Answer:

D

Explanation:

White Blood Cells Increase When Someone is Fighting an Infection or Sickness

Compare and contrast the frog's external anatomy with that of a mammal. State design advantages is has for its lifestyle.

Answers

Answer:

[tex]\color{Blue}\huge\boxed{Answer} [/tex]

Human body has muscular partition called as diaphragm to separate abdomen by chest frog lacks it.

Explanation:

Frogs do not have outer ear which mammals have.

Frog is an amphibian

Integumentary system to protect skin from external environment., mammals have glandular skin.

skin to inhabit water habitat skin has glands, hair, mammary gland and fur

Frogs have two forelimbs and two hind limbs. mammals have 4 forelimbs.

presence of cloaca for waste, sperm and egg release while mammals have anus, urethra and genital openings for the purpose.

ADVANTAGES OF EXTERNAL FEATURES IN LIFESTYLE:

The frogs body id designed streamlined for swimming as presence of flat skull, no neck and small waist.

The skin allows exchange of gases and allows them to breathe through skin.

Powerful hind legs assist them in jumps.

they have 3 eyelid membrane that helps them see in water or land.

Which of the following is used as biochemical evidence for evolution? *
a. Similarities in bone structures
b. Similarities in DNA
c. Fossil record
d. Similarities in eye function

Answers

B and c, all living organisms have it because it performs very basic life functions

What structure is found in viruses but not in cells

Answers

Answer:

Acellular

Explanation:

Viruses are acellular, meaning they are biological entities that do not have a cellular structure. Therefore, they lack most of the components of cells, such as organelles, ribosomes, and the plasma membrane.

What line represents the predator and which line represents the prey?

Answers

Answer:

La interacción biológica entre uno y otro consiste en que el predador o depredador da cacería a la presa y se nutre de la materia orgánica de su cuerpo, obteniendo así la energía y la materia necesarias para subsistir.

Explanation:

Cell city diagram feature components

Answers

Answer:

The cell structure comprises individual components with specific functions essential to carry out life's processes. These components include- cell wall, cell membrane, cytoplasm, nucleus, and cell organelles. Read on to explore more insights on cell structure and function.

The different forms of the beef cattle color gene are called_

Answers

The answer is right there click on it 271 the beef is colored red

The different forms of the beef cattle color gene are called "alleles"

What are alleles?

Alleles are alternative versions of a gene that arise from mutations and are located at the same position on a chromosome.

In the case of beef cattle, the color of the animal is determined by the interaction of multiple genes, including the color gene. The color gene can have different alleles that influence the color of the animal's coat. For example, one allele may result in a black coat color, while another allele may result in a red coat color.

The combination of alleles that an animal inherits from its parents determines its genotype, which in turn determines its phenotype or observed traits. Therefore, the different alleles of the beef cattle color gene can result in different coat colors, patterns, and markings in the cattle population.

Learn more about alleles, here:

https://brainly.com/question/14104138

#SPJ6

Give an example of 3 detrivores. On what do they feed?

Answers

Answer:

Sea cucumber,Vulture,  and worms

they feed on dead organisms

Explanation:

Answer:

Vultures, worms, and crabs

Explanation:

they feed on dead organisms

hey can someone answer pls?
will mark branliest and follow thanks!​

Answers

A is  correct

////

key word different

AAAAAAAAAAAAAAAAAAAA

Other Questions
Calculate the number of moles in 40g of Al(OH)3 a example of metaphor and explain the metaphor Write a scientific explanation as to What is the main cause of global warming?" What is the relationship between Nike with the Second Industrial Revolution? Which expression is equivalent to 7x(yz - 7 - 2y) A 9-inch diameter pizza has 30 calories per square inch. About how many calories are in the entire pizza?Use 3.14 for pi. Amelia is using substitution to determine if 8 is a solution to the equation. Complete the statements. 6a = 42 for a = 8 First, Amelia must substitute 8 for the using To simplify, Amelia must 8 a solution of the equation. pls hurry I'm on timer what were the social achievements of rana regime? HELP ME PLS! ASAP 10 POINTS FOR THIS ONE & THE NEXT ONE!!!!!! can someone please help me What was Kristallnacht? a. an attack on Jewish homes, businesses, and synagogues in Germany b. a ship full of Jewish refugees denied entry in the United States c. a set of laws denying Jews of their German citizenship, jobs, and property d. a group of highly educated Jewish refugees allowed into the United States Find the circumference and area of a circle A with a diameter of 26 inches. Please I need the answer ASAP. Thank you very much. where did Jewish immigrants to South africa come from what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? Did I do this right? if I didn't get it right can you help me? Thank you! Determine which number is a solution to the inequality. These four numbers are plotted on a number line:-23,58,-35,-12Which is the correct ordering on the number line, from left to right? A . -12,-35,-23,58 B. -12,-35,58,-23 C. -23,-35,-12,58 D. -35,-23,-12,58 Mahi has 31 rolls of string. Each roll holds 12 yards of string. How many feet of string does she have? can anyone tell me my mistakes pls? Help me pleas I need help to solv this problem