write a real world problem that could be represented by 1/5 x 5 = 1

Answers

Answer 1

Answer:

Each person received 1/5 of a pizza. There were 5 people in total. How much pizza was there originally before the split?


Related Questions

Where does the graph of f(x) = (x + 9)(x - 4) cross the x-axis?​

Answers

hi

f(x) = (x+9)  (x-4)

if it's cross the  x axis it's means  f(x) = 0

(x+9) (x-4) = 0  means   x+9 = 0  so x = -9  and   x-4 = 0 so x = 4

answers f(x) = 0 for  x = -9 and  x = 4

The length of a rectangle is 3 yards less than 5 times the width. If the perimeter is 102 yards, find the length and the width of the rectangle.

Answers

Answer:

Width = 9 yards, length = 42 yards

Step-by-step explanation:

Perimeter = 2xlength + 2xwidth. Let's call length L and width W. The question also states that L = 5W-3. Therefore, 102 = 2x (5W-3) + 2W. Then, 102 = 12W - 6. 108 = 12W, so W = 9 yards. Since L = 5W - 3, we get 45-3 = 42 yards.

W = 9 yards L= 42 yards

Ms. jones wants to take her students for all of her classes on a field trip to see a Broadway production. There are three shows to choose from. She wants to determine which show students would like to see. which sample would be the most appropriate for this survey?

A: Every fifth student that enters her classroom

B: Her Honors class

C: 5 boys in each of her class

D: At the end of the day, ask teachers what they think student will like

Answers

Answer:

A

Step-by-step explanation:

Because it is a random sample

Order the following numbers from least to greatest: 2.74, 1/9, 4^2, -2^3, 32.5%,-6

Answers

Answer:

2

3

,

6

,

1

9

,

32.5

%

,

2.74

,

4

2

Step-by-step explanation:

I NEED HELP PLZ ( WILL GIVE BRAINLIST) NO LINKS

Answers

Answer:

2 1/2

Step-by-step explanation:

i used the  lwh for this/ (length) (width) (height)

Branliest will be appreciated and thanks!

25 - [2x(18 divided by 3) + 2

Answers

Answer:

the answer is 11

Step-by-step explanation:

if you take 18 divided by 3 and then 2 times that plus 2 and minus 25 it is 11

offering 19 points to whoever can solve this need the answers

Answers

Answer:

Excuse Me! I believe you forgot to add your question and or picture with the question(s) in it! I would highly recommend to re-upload your question(s) to get the desired information needed!

Yours Truely, TheAnimeCatUwU

PLEASE HELP ME ANSWER!!!

Answers

Answer:

61.3°

Step-by-step explanation:

For angle x, 12 is the adjacent leg. 25 is the hypotenuse.

The trig ratio that relates the adjacent leg and the hypotenuse is the cosine.

cos A = adj/hyp

cos x = 12/25

x = cos^-1 12/25

x = 61.3°

A nurse is investigating the birth weights of​ non-premature babies. She selects a random sample of 41 such​ babies, and found a mean weight of 3506.4 grams and a sample standard deviation of
494.2 grams. Find a 95​% confidence interval for the mean birth weight of all ​non-premature babies. Show your calculation for the confidence interval as well as the final confidence interval rounded to one decimal place. Then write a sentence that gives the interpretation of your confidence​ interval, including the correct units.

Answers

Answer:

The 95​% confidence interval for the mean birth weight of all ​non-premature babies is between 3350.4 grams and 3662.4 grams. This means that we are 95% sure that true mean birth weight of all non-premature babies is in this interval.

Step-by-step explanation:

We have the standard deviation for the sample, which means that the t-distribution is used to solve this question.

The first step to solve this problem is finding how many degrees of freedom, we have. This is the sample size subtracted by 1. So

df = 41 - 1 = 40

95% confidence interval

Now, we have to find a value of T, which is found looking at the t table, with 40 degrees of freedom(y-axis) and a confidence level of [tex]1 - \frac{1 - 0.95}{2} = 0.975[/tex]. So we have T = 2.0211

The margin of error is:

[tex]M = T\frac{s}{\sqrt{n}} = 2.0211\frac{494.2}{\sqrt{41}} = 156[/tex]

In which s is the standard deviation of the sample and n is the size of the sample.

The lower end of the interval is the sample mean subtracted by M. So it is 3506.4 - 156 = 3350.4 grams

The upper end of the interval is the sample mean added to M. So it is 3506.4 + 156 = 3662.4 grams

The 95​% confidence interval for the mean birth weight of all ​non-premature babies is between 3350.4 grams and 3662.4 grams. This means that we are 95% sure that true mean birth weight of all non-premature babies is in this interval.

Conduct the following test at the level of significance by determining ​(a) the null and alternative​ hypotheses, ​(b) the test​ statistic, and​ (c) the​ P-value. Assume that the samples were obtained independently using simple random sampling. Test whether . Sample data are ​, ​, ​, and . ​(a) Determine the null and alternative hypotheses. Choose the correct answer below. A. versus B. versus C. versus Your answer is correct.D. versus ​(b) The test statistic is nothing. ​(Round to two decimal places as​ needed.)

Answers

Answer:

Hello your question is poorly written the complete question is attached below

answer :

a) H0 : p1 = p2

  Ha : p1 ≠ p2

b)  Z = -0.58

c) P-value =  0.561915

d) we will reject the Alternative hypothesis

Step-by-step explanation:

For sample 1 ;  n1 = 254 , x1 = 28

For sample 2 ; n2 = 301 , x2 = 38

level of significance ∝ = 0.01

P1 = X1 / n1 = 28 / 254  = 0.1102

P2 = X2 / n2 = 38 / 301 = 0.126

a) Determine the null and alternate hypothesis

H0 : p1 = p2

Ha : p1 ≠ p2

b) Determine Test statistic

we perform a Z-statistic to test the hypothesis

Z = [tex]\frac{p1-p1 }{\sqrt{( p(1-p)*(\frac{1}{n1}+\frac{1}{n2}) ) } }[/tex]  -------- ( 1 )

p =  ( x1 + x2 ) / ( n1 + n2 )

= ( 28 + 38 ) / ( 254 + 301 ) = 0.1189

Where: p = 0.1189 , p1 = 0.1102 , p2 = 0.126 ( input values into equation 1 )

∴ Z = -0.58

c) Determine P-value

P-value =  0.561915 ( using excel function )

d) conclusion : since p-value > 0.01 ( level of significance ) we do not reject the null hypothesis.  therefore it proves that p1 = p2

Jamal can run 0.5 miles in 4 minutes. If he keeps the same pace and runs for 14.4 minutes, how many miles will he have run?

Answers

Answer:

1.8

Step-by-step explanation:

First, we calculate the speed. That is 0.5/4. Then we multiply by the min. he ran which is 14.4. The answer gets you to 1.8

By the way, can you follow me on Brainly?

Thanks!

Answer:

14/4=3.5

3.5x0.5=1.75 miles

He will have run 1.75 miles

Who knows the answer for this problem

Answers

- Each friend has 10 nails to paint

- There are 8 friends

- Jackie finished painting 4 friend's nails

If there are 8 friends, and each friend has 10 nails to paint, then there are 80 nails that need to be painted in total.

Jackie finished painting 40 nails.

So the math sentence will be:

80 - 40 = 40

--------------------------------------------------

Jackie needs to paint 40 more nails.

26.5 multiplied by 0.38

Answers

10.07 would be the answer

Answer:

10.07

Step-by-step explanation:

26.5 x 0.38 = 10.07

Can I get brainliest

The green arcs show a pair of SAME SIDE INTERIOR ANGLES.

Drag the two black points to show another pair.

Same side interior angles are:
Always congruent
Sometimes congruent
Never congruent
Explain your thinking.

Answers

It would be purple and green


(2 + 3x)
62
Angle Relationship: Adjacent OR Vertical

Answers

Answer:

adjacent

Step-by-step explanation:

1. Josh is reading a book that contains 100 pages. If he reads 1/3 of the book in 1/6 of an hour, how many pages per hour does Josh read?​

Answers

100/3=33.33.... 1/6= 10 mins 33.33....*6= 199.98

hope this helped you out!!

yo can someone pls help me with this i’ve been crying for the last hour bc i can’t figure it out and it’s due in 30 minutes. the question is “find the area and perimeter to this composite figure”. i will give you the most brainly if you answer and solve. thank you <3

Answers

9514 1404 393

Answer:

area: 524 cm²perimeter: 124.8 cm

Step-by-step explanation:

The rectangle in the middle has a width equal to the radius of the semicircular ends, so (20 cm)/2 = 10 cm.

The semicircular ends, together, make a complete circle of radius 10 cm.

The area is the sum of the areas of the parts:

  A = LW = (21 cm)(10 cm) = 210 cm² . . . . . . rectangle area

  A = πr² = π(10 cm)² = 100π cm² ≈ 314 cm² . . . . . circle area

The total area is ...

  210 cm² +314 cm² = 524 cm² . . . . area of the figure

__

The perimeter of the figure is the sum of the lengths of all of the edges. From the left, working clockwise, we have ...

  P = (1/2 circle of diameter 20) + (rectangle top = 21) +(1/2 circle of diameter 20) +(circle radius = 10) +(rectangle bottom = 21) +(circle radius = 10)

The two 1/2 circles add to a whole circle with a circumference of ...

  C = πd = (3.14)(20 cm) = 62.8 cm

Then the whole perimeter is ...

  P = 62.8 cm + 21 cm + 10 cm + 21 cm + 10 cm = 124.8 cm

_____

Note that we have used 3.14 for pi. If you use a more exact value, your answers will be slightly different.

Plz show work, NEED HELP FAST PLZ

Answers

Answer:

5. 4        6. 6

Step-by-step explanation:

Number 5

[tex]10-2\sqrt{9}[/tex]

[tex]2\sqrt{9}=6[/tex]

[tex]=10-6[/tex]

Subtract the numbers: 10 - 6 = 4

[tex]=4[/tex]

Number 6

[tex]70-\left(\sqrt[3]{64}\right)^3[/tex]

[tex]\left(\sqrt[3]{64}\right)^3=64[/tex]

[tex]=70-64[/tex]

Subtract the numbers: 70 - 64 = 6

[tex]=6[/tex]

I WILL MARK BRAINLIEST IF CORRECT! Look at the image below.

Answers

Answer:

C 1/10 × 33

D 0.1 × 33

Hope that helps

hi can you please help me with my work​

Answers

the answer is the second one. 2 and 2/3

Someone please please help me with this!!!

Answers

Answer:

[tex]4x {}^{2} - 36 \\ = (2x + 6)(2x - 6) \\ hence \: option \: b \: is \: correct[/tex]

Complete the square in the following quadratic equation

Answers

Answer:

x^2 + 2x = 1 = - 1

Step-by-step explanation:

x^2 + 2x + 3 = 1

x^2 + 2x + 3 - 2 = 1 - 2

x^2 + 2x + 1 = - 1

50 POIINTS!!!
A coin is flipped 20 times. The results are 12 heads and 8 tails. Determine the theoretical probability of getting heads.

60%
40%
20%
50%

SOMEONE PLEASE PUT STEPS TO SOLUTION.

Answers

Answer:

What we have here is experimental probability:   12 heads out of 20 tosses. The fraction 12/20 reduces to  6/10, or 0.60, which corresponds to 60%.

Answer the question in the picture plz

Answers

A number raised to a fraction would be the same as a root to the inverse of the fraction.

What that means is the sqrt(8) raised to 1/4 is the same as being 4th root of 8.

So rewriting the given equation you would have cubic root 8 x 4th root 8

Combine the roots by multiplying: 3 x 4 = 12

The equivalent equation would be C. 12 root 8 ^ x

Dana bought 144 pencils for $8.64.which equation could be used to determine the cost of each pencil,x?
A.144/8.64=x
B.x/144=8.64
C.8.64-x=144
D.144x=8.64​

Answers

Answer:

144x=8.64

This way you can divide by 144 to find how much each individual pencil costs

red die and a blue die are rolled. You win or lose money depending on the sum of the values of the two dice. If the sum is 5 or 9, you win $6. If the sum is 6, 7, or 12, you win $2. If the sum is any other value (2, 3, 4, 8, 10, or 11), you lose $4. Let X be a random variable that corresponds to your net winnings in dollars. What is the expected value of X

Answers

Answer:

The expected value of X is $0.2222.

Step-by-step explanation:

A probability is the number of desired outcomes divided by the number of total outcomes.

For each dice, there are 6 possible outcomes(values from 1 to 6). So for 2 dices, there are [tex]6^2 = 36[/tex] possible outcomes.

Desired outcomes:

Sum 5: (1,4), (2,3), (3,2), (4,1).

Sum 6: (1,5),(2,4),(3,3),(4,2),(5,1)

Sum 7: (1,6), (2,5), (3,4), (4,3), (5,2), (6,1)

Sum of 9: (3,6), (4,5), (5,4), (6,3);

Sum of 12: (6,6)

Probabilities:

4 + 4 = 8 outcomes with a sum of 5 or 9.

8/36 = 2/9 probability of a sum of 5 or 9.

12 outcomes with a sum of 6, 7 or 12.

12/36 = 1/3 probability of the sum being 6, 7 or 12.

36 - 20 = 16 outcomes in which the sum is any other value. So

16/36 = 4/9 probability of a sum of any other value.

What is the expected value of X?

2/9 probability of earning $6.

1/3 = 3/9 probability of earning $2.

4/9 probability of losing $4.

Multiplying each outcome by its probability, we find the expected value. So

[tex]E = \frac{2}{9}*6 + \frac{3}{9}*2 - \frac{4}{9}*4 = \frac{12 + 6 - 16}{9} = \frac{2}{9} = 0.2222[/tex]

The expected value of X is $0.2222.

7
1. Represent these numbers on the number line. (i)7÷4​

Answers

Answer:

Answer is in picture

Step-by-step explanation:

Hope it is helpful.....

A line has a slope of -5 and includes the points (-1,r) and (-2,-2). What is the value of r?

Answers

Answer:

-7

Step-by-step explanation:

What is the volume of the rectangular solid below?
plzzzz help

Answers

16 cubic inchessssss

a bakery place the following price for bagels one bagel for $1.50 two bagels for$2.25 a half a dozen for
$6.50 a dozen for $12 is the price per bagel proportion 2 the number of bagels brought.​

Answers

Answer:

no

Step-by-step explanation:

1 bagel $1.50     ---------> unit cost: $1.50/bagel

2 bagels $2.25

6 bagels $6.50

12 bagels $12    ---------> unit cost: $1/bagel

Since the unit costs are not equal, the prices are not proportional.

Other Questions
When trying to simplify and find the equivalent resistance you should first simplify resistors in _ before simplifying those in _ LOOK AT PIC! which table shows y as a function of x? Explain how the islands of Sicily and Sardinia positively impacted ancient Romans. Income statement under absorption costing and variable costingThe following information applies to the questions displayed below.Cool Sky reports the following costing data on its product for its first year of operations. During this first year, the company produced 42,000 units and sold 34,000 units at a price of $140 per unit. Manufacturing costs Direct materials per unit $60 Direct labor per unit $22 Variable overhead per unit $8 Fixed overhead for the year $504,000 Selling and administrative costs Variable selling and administrative cost per unit $12 Fixed selling and administrative cost per year $115,0001a. Assume the company uses absorption costing. Determine its product cost per unit. 1b. Assume the company uses absorption costing. Prepare its income statement for the year under absorption costing. 2a. Assume the company uses variable costing. Determine its product cost per unit.2b. Assume the company uses variable costing. Prepare its income statement for the year under variable costing. Fire: heat as night : darkness analogy luciana is adding water to a pool Jacob was assigned recently to a large team working on a major software release that was taking longer than expected. Jacob and the other latecomers into the project spent a month partnered with a senior programmer who went over the project in detail with them and got them up to speed. Unfortunately, this training put the project even farther behind schedule. After a few months of working on the project with many other programmers, Jacob's work output becomes noticeably lower than it was before when he was working independently. Jacob's reduced work output is most likely due to Help me out. Mathmatics someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others. Which detail from paragraphs 22-25 best supports the concept of the "democratization" of social media in paragraph 22?A "mainstream media and institutions tend to invisibilizewomen, Howard says, the truth is getting more and moredifficult to ignore as these women so visibly lead the charge (Paragraph 22)B "they're working on a Juneteenth celebration with food trucks, speakers and performers - something to bring people together as the nation commemorates the end of slavery" ( Paragraph 23)C "Thomas anticipates she'll be busy organizing more events throughout the summer" (Paragraph 24)D "We're going to be dedicating our time to this to make sure things actually happen, Thomas says." ( Paragraph 25) Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down How does learning a different language helps you with communication skills find the area of the triangle answer in digital format only Malcolm is filling bags with rice. He starts with a 5 1 over 4 pound container of rice and fills eachbag with pound of rice. How many bags of rice can Malcolm fill? Name that meme -For 50 Points The school nurse took care of five students on Monday and four of the five students had a cough. The school nurse determined that 80% of the students in her school were coming down with colds. Which of the following would best describe why her conclusion was invalid?