Answer:
Mr. Evil, thinks that he will be able to tunnel from Snively's grandmother's house to Daly City bank because when the plate slides (the one that has Snively's grandmother's house) close enough to the bank; he will be able to dig a tunnel into the bank.
If the carrot population increased, the rabbit population would:
NO LINK ANSWERS
A. increase
B. decrease
C. remain the same
Answer:
The rabbit population would remain the same as the increase in number of carrots doesn't determine / effect the population of rabbits.
Hope my answer helps !
Answer:
i believe the answer is c) remain the same
Explanation:
i say this because food availability wouldn't necessarily cause the population to grow (there would need to be an environmental change for this to happen.)
and the population wouldn't decrease because there would be an abundance of food and since starvation is one of the main causes of population decrease (along with over-crowding.)
good luck :)
i hope this helps
**please let me know if this was incorrect**
have a nice day!
PLEASE HELP!!! I'll mark the first correct answer brainliest!!! 9. A gene has the base sequence that starts with: TAG CAT GGC AT
a) What would be the mRNA base sequence formed during transcription, using the DNA sequence shown above? (3 points)
b) What would be the first three amino acids in the protein formed from this gene? (3 points)
c) The gene has a mutation and is changed to the sequence below.
TAG CTT GGC AT
What kind of mutation is this? (2 points)
d) What is the new mRNA strand formed by this gene? (3 points)
e) What are the new amino acids formed from this gene? (3 points)
f) Describe how the mutation has affected the protein coded by this gene. (3 points)
The mRNA base sequence formed during transcription, using the DNA sequence TAG CAT GGC AT would be: AUC GUA CCG UAG. The first three amino acids in the protein formed from this gene would be: Isoleucine, Valine, and Proline. The new mRNA strand formed by this gene due to the mutation would be: AUC GUU GCC UAU
What are the new amino acids formed from this gene?The new amino acids formed from this gene due to the mutation would be: Isoleucine, Leucine, and Cysteine (since the codons for these amino acids are AUG, CUU, and UGU respectively).
Describe how the mutation has affected the protein coded by this gene.The mutation has affected the protein coded by this gene by changing the second amino acid from valine to leucine. Depending on the specific protein, this could potentially impact its function and structure, which could affect the organism's phenotype.
To learn more about phenotype, visit here:
https://brainly.com/question/28474179
#SPJ1
Describe one method to reduce the air pollutants released from a coal burning power plant
Answer:
A method to reduce the air pollutants released from a coal burning power plant is carbon capture.
Explanation:
Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.
Why might scientists be interested in using algae for biofuel production?
Answer:
Algae actively absorb carbon dioxide, and therefore reduce the greenhouse effect. Fuel from microalgae is called third-generation biofuel, and development for its production is currently underway. With sufficient information on the composition of biofuels, researchers can significantly improve production processes.
Explanation:
Carbon, hydrogen, and oxygen from sugar molecules may combine with other elements to form other biomolecules. The picture
above shows an example of this. Examine the model and choose ALL of the statements that accurately describe the formation of the
new biomolecule.
A)
Proteins are being formed.
B)
The monomers are amino acids.
o
This is a hydrolysis reaction.
D)
Carbohydrates are being broken down.
E)
This is a dehydration synthesis reaction
The following statements are true from the image;
Proteins are being formed.The monomer, are amino acids.Many biomolecules are naturally occurring polymer substances. In this case the biomolecule that is being formed is a protein.
A protein is composed of several peptide bonds formed from amino acids. Hence, the monomer in this case are amino acids from which polypetides and proteins are formed.
Learn more: https://brainly.com/question/1443134
What occurs when someone exhales? A. The rib cage contracts, but the diaphragm relaxes. B. Both the rib cage and the diaphragm relax C. Both the rib cage and the diaphragm contract. D. The rib cage relaxes, but the diaphragm contracts
Answer:
Answer is A ............
Edit: its actually D... i just verified
Answer:
The answer be D if you doubt you can try out the practical yourself.
I mark Branliest for the correct answer quickly please listen to me Eyes Blue
Answer:
1(i think)
Explanation:
The nucleus controls and regulates the activities of the cell (e.g., growth and metabolism) and carries the genes, structures that contain the hereditary information. Nucleoli are small bodies often seen within the nucleus. The gel-like matrix in which the nuclear components are suspended is the nucleoplasm.
A cloud of dust and gas in space were stars are formed is a _____ .
Answer:
nebula
Explanation:
How is energy produced by respiration stored
Answer:
Explanation:
Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.
Answered by the ONE & Only #QUEEN aka #DRIPPQUEENMO
Hope this helped!!!
In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine
Answer:
31%
Explanation:
Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If
G = 19% then C= 19%
19% + 19% = 38%
100% - 38% = 62%
62% for A and T
Divide by 2 and you get
31%
Water in the blood helps carry nutrients and gases required foe survival througout the body. Which characteristics of water allow for this action?
A.water has a neutral pH
B.water maintains temperature
C.what expands when it freezes
D.water dissolves many compounds
Answer:
Water has a neutral pH
Explanation:
None of the others exactly fit in with what this is saying, and water having a neutral pH allows the supplies and nutrients that it carries to stay safe within it throughout the way.
Sorry if this isn't correct or full-fledged explained like I normally do, I saw you said to hurry up and I didn't do my normal research and whatnot.
Anyways, hope this helped!
Sources: N/A
The characteristic of water that allows this process of carrying nutrients and gases is water has a neutral pH. Thus, the correct option for this question is A.
What are the characteristics of water?The characteristics of water are as follows:
It is a universal solvent. Due to the partial positive charge on hydrogen and partial negative charge on oxygen, it is a polar molecule. It has high heat capacity and high heat of vaporization. It has properties like cohesion and adhesion. Its solid form is less dense as compared to liquid.Due to having the property of neutral pH, water significantly performs movement across the entire body with the help of blood.
It does not form any barrier with the differences in the level of pH. So, along with blood, water carries nutrients and gases that must be required for proper survival throughout the body.
Therefore, water that has a neutral pH is the characteristic property that allows the carrying of nutrients and gases required for survival throughout the body.
To learn more about The properties of water, refer to the link:
https://brainly.com/question/18681949
#SPJ6
Which of the following is an example of a producer-consumer
relationship?
productor?
Worm --> Bird
Leaf --> Tree
Fish --> Bear
Grass --> Deer
Answer:
Grass and Deer
Because Grass is consumer and Deer is producer
is the following truth or false? lava flows on the moon sometimes overlap highlands, showing that maria deposits are younger than highlands
Answer:
false
Explanation:
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?
Answer:
Tfftfxggfddsd
Explanation:
Because of the condons
PLZZZ HELP MEEEE!!!
The horse latitudes are areas of calm bordered on either side by the prevailing westerlies and what other wind belts?
A. jet streams
B. polar easterlies
C. trade winds
D. doldrums
Answer:
es la c. trade winds o es la A. jet streams
16.2.2 Why is it important to complete a course of antibiotics?
Which of these is NOT true about vaccines?
a. they simulate a specific immune response
b. they cause memory cells to be produced
c. they contain an antigen of a weakened pathogen
d. it has been proven that there are many possible negative side-effects to being vaccinated
Answer:
I'm going to say A
Explanation:
because it just make more sense
refer(s) to an individual's preference for emotional sexual relationships with members of the opposite sex (heterosexuality), the same sex (homosexuality), or both (bisexuality). A) Sexism B) Gender identits C) sexual identification D) Sexual orientation
Answer:
D. Sexual orientation
Explanation:
Hope this helps! Have a nice day!
12 POINTS!!
Semiconductors are materials that conduct electric current better than insulators but not as well as conductors.
Please select the best answer from the choices provided
T
F
Answer:
True
Explanation:
Hope this helps!
Answer:
True :)
Explanation:
what is an indication that water is entering a cell?
Answer:
water decreasing from where it came from
Explanation:
that or the cell starts to swell
Write a scientific explanation as to “What is the main cause of global warming?"
Answer:
It is the aspect of climate change
Explanation:
Referring to the long term rise of planet's temperatures,it is caused by increased concentrations of greenhouse gases in atmosphere
Answer:
Excess C02 in the atmosphere caused by coal burning, exhaust, factory smokestacks, and deforestation.
Explanation: i am sorry if this is wrong
B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?
Here's li[tex]^{}[/tex]nk to the answer:
bit.[tex]^{}[/tex]ly/3tZxaCQ
Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?
Answer:
i dont know i need points
Explanation:
Body systems interact with one another to carry out life processes. Movement is an important function in animals. Which body
systems work with the skeletal system to enable voluntary movement of the organism? Choose ALL that apply.
A)
nervous system
B)
muscular system
C)
endocrine system
D)
lymphatic system
E)
circulatory system
Answer:
B
Explanation:
Because it's the muscle helps the body system with the skeletal system to enable voluntary movement of the organism
Explain how cellular respiration is important for the production of ATP build on aerobic vs anaerobic
Answer and Explanation:
ATP is the energy molecule of the organism, being necessary for all cellular processes. It is produced in both aerobic and anaerobic respiration, but the processes are different.
Aerobic respiration, ATP is produced by breaking down the glucose molecule found in the food we consume. This process occurs in all organisms that need the presence of oxygen to survive. However, this is a complex process that occurs with the help of several enzymes and co-enzymes that perform various oxidation reactions on the glucose molecule, transforming it into carbon dioxide, water and ATP.
Anaerobic respiration is also known as fermentation and occurs in all organisms that cannot survive in the presence of oxygen. This process also occurs with the help of enzymes and coezimas, where the glucose molecule is degraded until it becomes two molecules of pyruvate. During the pyruvate degradation reactions, an ADP molecule is released, which will later be added to a phosphate molecule that is free in the cytosol, becoming ATP.
Cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. Only list the phenotypic ratio at the end.
Answer:
The phenotypic ratio is 9:3:3:1
9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraaExplanation:
We need to cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. When referring to a hybrid plant for a trait, we are meaning that the plant is heterozygous for that trait.
Let us assume that round is the dominant trait, codified by a diallelic gene, so
R is the dominant alleler is the recessive alleleLet us also assume that axial is the dominant trait, so
A is the dominant allelea is the recessive alleleCross:
Parentals) RrAa x RrAa
Gametes) RA, Ra, rA, ra
RA, Ra, rA, ra
Punnett Square) RA Ra rA ra
RA RRAA RRAa RrAA RrAa
Ra RRAa RRaa RrAa Rraa
rA RrAA RrAa rrAA rrAa
ra RrAa Rraa rrAa rraa
F1) Among the progeny, we expect to observe the following phenotypic ratio:
9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraaplease answer this question asap!!!!
Answer:
The 2ND one and the 4th one I'm pretty sure
Someone’s help me please
Answer:
trailmix
Explanation:
Someone plz help me! ☺️
What processes can increase the amount of atmospheric CO2?
Answer:
Explanation:
Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt.
Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.
Answered by the One & ONLY #QUEEN aka #DRIPPQUEENMO
Hope This Helped !! :)
