Which zone of the open ocean never receives solar radiation, temperatures are just above freezing
and contains constant high density water?
transition zone
O surface mixed zone
O deep zone

Answers

Answer 1

Answer:

deep zone

Explanation:

it's temp is just above freezing


Related Questions

Clasts
Layer A
Layer B
Layer C
Fossils
Layer D
15. Based on the law of superposition, which layer of sedimentary rock is
the oldest?
O A. Layer C
O B. Layer B
O C. Layer D
O D. Layer A

Answers

Layer D is the oldest because it is the deepest.

G
What percentage of Japan's population is over 65 years old?
A. 20%
B. 25%
C. 35%
D. 50%
Please select the best answer from the choices provided
A

Answers

Answer:

25%

Explanation:

Need help with this question, thank you :D

Answers

Answer:

Explanation:

its B

helppp please thank you so much

Answers

Answer:

sorry but i can't see it im so sorry

What are the sources of the energy that drives the earth’s processes?
Select one:

A. The sun and the earth’s interior.
B .The sun and chemical reactions.
C. The earth’s interior and chemical reactions.
D. The earth’s interior and gravity.

Answers

Answer:

Most of the energy in the Earth system comes from just a few sources: solar energy, gravity, radioactive decay, and the rotation of the Earth. Solar energy drives many surface processes such as winds, currents, the hydrologic cycle, and the overall climate system.

Explanation:

Hope it helps

Which type of tectonic plate boundary is located at mid ocean ridges

Answers

Answer:

Divergent plate boundaries

Explanation:

New ocean floor is created the Earth's tectonic plates spread apart.

Divergent plate boundaries.

Describe the change in the dominant economic sector during deindustrialization

Answers

Describe the change in the dominant economic sector during industrialization and during deindustrialization. One spatial change in manufacturing employment patterns as a result of deindustrialization is production shift. This is because it lowers the cost on labor and some places were made unfit for human contact.

The major change in the dominant economic sector  as a result of deindustrialization is production shift

During industrialization, the Textiles industry was the dominant industry during the Industrial Revolution.

Deindustrialization refers to the reduction of all industrial activity in an area or economy.

So, the major change in the dominant economic sector  as a result of deindustrialization is production shift.

Read more about deindustrialization

brainly.com/question/8390410

Which of the following events would most likely cause ecological succession in an ecoregion located in South Texas?

Volcanic eruption

Blizzard

Drought

Earthquake

Answers

Answer:

drought

Explanation:

because the south is a very hot place

Who needs help with their work?

Answers

Answer:

I usually don't but. Sure why not

Explanation:

Me please I really need help

100 rabbits produced 600 young in a year. That same year, 200 rabbits died. None migrated in or out of this population. What is the final size of the population of rabbits?

Answers

Answer400  rabits

Explanation:

because 600 minus 200

what is the cause of most earthquakes group of answers
a) Convection currents inside the earths mantle cause movements in the crust
b) rocks layers break apart along fault lines releasing large amounts of energy
c) volcanic eruptions like mt. saint Helen's are main cause of earth quakes
d) the earth crusts breaks away and moves suddenly into mantle ​

Answers

I believe it’s A
but that’s just my guess

does anyone have a bee essay/paper/document i can borrow

Answers

Answer:

I found a essay on bees I hope that it works!

Explanation:

https://sites.evergreen.edu/environmentalhealth/wp-content/uploads/sites/174/2016/03/EnvironmentalHealthProjectFinal.pdf

which feature causes a gap in the geologic record

Answers

Answer:

Unconformities Are Gaps in the Geological Record

Gaps in the geological record, like those discovered in 2005, are called unconformities because they do not conform to typical geological expectations.Explanation:

Answer:erosion

Explanation:

Name the two major projects developed by NHAI​

Answers

Answer:

Ministry of Road Transport and Highways.

National Highways Authority of India.

National Highways Development Project.

Expressways.

National highways (list)

State highways.

Bus rapid transit.

Motor Vehicles Act. 1988.

Explanation:

which of these land uses has an impact on the environment ? describe what impact would be

Answers

Impact of land use on the environment
Environmental Impacts
Land–use change is arguably the most pervasive socioeconomic force driving changes and degradation of ecosystems. Deforestation, urban development, agriculture, and other human activities have substantially altered the Earth's landscape.

In 1952 London England, 4,000 people died of a type of foggy smog. What would be the probable cause for this pollution
A) The daily primary pollution added to secondary pollution created a killer fog.
B) Industries were burning too much coal and heavy oil and it created smog.
C) The surrounding countryside had an overpopulation of grazing animals emitting too much
ammonia.
D) The number of diesel road vehicles such as cars, buses, and trucks tripled after World War II.
E) None of the above.

Answers

Answer:

I think it is B......

Explanation:

the killer smog of London 1952 was caused by thousands of people burning domestic furnaces because it was so cold outside. The smog from the coal furnaces is what caused primary pollution and particulate matter in the air. Industries were also burning fuel at the time.

What was a major goal of the common schools movement?


To establish a set of values that would be acceptable to both secular and religious institutions

To establish the opportunity for caregivers to choose to school their children at home, or not school them at all, if they wished

To establish academic standards to make sure children across the country were all learning the same concepts and skills

To establish public schools in order to give all children, regardless of financial or cultural background, access to an education

Answers

Answer:

Corect and yes so yes cool

Its 3

Explanation:

To give every child the right opportunity to access quality and standard education

what belief system was endorsed by the state that ruled the Holy Land in 550 CE

Answers

Answer:

After the death of Jesus of Nazareth, Christianity spread throughout the Roman Empire. Like Jewish people, Christians were persecuted by the Romans, but over the course of hundreds of years its popularity overcame the persecution and the empire adopted Christianity as the only authorized religion in 380 CE.

Explanation:

what is the other name for doldrum​

Answers

Answer:

The other name for doldrum is called equatorial calms.

Explanation:

Hope this helps! :)

Prove quadrilateral ABCD Is a parallelogram A(-2, 8), B(2, 7), C(5, 1), and D(1, 2)

Answers

Answer:

The solution is given below;

Explanation:

The explanation is as follows:

Given that

The coordinates are

A(-2, 8), B(2, 7), C(5, 1), and D(1, 2)

Based on this if the particular figure would be considered as a parallelogram

So,

A + C = B + D

(-2, 8) +(5, 1) = (2, 7) +(1, 2)

(-2+5, 8+1) = (2+1, 7+2)

(3, 9) = (3, 9)

As both are equivalent

Therefore ABCD is a parallelogram

1. What
happened
during the
Warring
States
period?

Answers

Answer: During the Warring States Period, nobles stopped supporting the Zhou Dynasty (1046–221 BC), and Zhou's vassal states declared themselves independent from Zhou, becoming kingdoms or warring states. Chu became the biggest state. It controlled the southern third of the entire region of the Warring States.

HOPE THIS HELPS

Answer:

The Warring States Period in China (475-221 BC) ... TheWarring States Period (475–221 BC) was an era of division in ancient China. After the relatively peaceful and philosophical Spring and Autumn Period, various states were at war before the Qinstate conquered them all, and China was reunited under the Qin Dynasty.

Choose all the answers that apply.

Jupiter:

rotates upside-down
is the largest planet
is the most massive planet
is the least dense planet
has retrograde rotation

Answers

Answer:

Explanation:  

1.Jupiter is the largest planet.  

2.Jupiter is the most massive planet.

 

There are 8 planets in the solar system. Jupiter lies beyond the asteroid belt. It is the largest and most massive planet of the solar system. It does not have retrograde motion. Saturn is the second largest planet and is the least dense planet. Jupiter is composed of mostly hydrogen and helium. Jupiter's axis of rotation is tilted to about 3.13 degrees. It does not rotate upside down.

Answer:

i got it right :)

Explanation:

Which substance will the most water flow through and why? (sand, gravel, clay)

Answers

Answer:

gravel

Explanation:

because it contains large air spaces thus allowing water to pass through

if you buy a chocolate bar how might that affect chocolate makers in europe ?​

Answers

it could increase the price potentially!!

What are some social, economic, and political challenges of South America?

Answers

Answer:

a slowdown in growth due to an inability to achieve continuous improvements in competitiveness and productivity;

the poor quality of education and the slow transfer of knowledge and innovative ideas; and.

excessive inequality and lack of social protection.

Explanation:

If the North Pole is having summer, what season is the South Pole having?

Answers

Answer: winter the end of winter

Explanation:

Answer:

Winter

Explanation:

Remember that whatever the North Pole is having, the South Pole is the exact OPPOSITE. (North and South are also opposites)

Who attended the Berlin conference (1884-1885), and what did they do there?

Answers

Answer:

Berlin Conference of 1884-1885 The Berlin Conferencewas a meeting of 14 nations to discuss territorial disputes in Africa. The meeting was held in Berlin, Germany, from November 1884 to February 1885 and included representatives from the United States and such European nations as Britain, France, and Germany.

Explanation:

brainly plz need 3

Desertification occurs when drought and human activity destroy once-fertile land and water resources. The Sahel region of the Sahara is an area particularly affected by desertification. Lake Chad, located within the Sahel, is now referred to as “Africa’s disappearing lake,” as it is literally shrinking. Watch this video on desertification and read this article about Lake Chad. Based on what you learn from these resources, write a brief essay giving specific examples of how human activity has contributed to the problem of desertification in the Sahel region. How has the problem affected Lake Chad? How has it endangered the local population’s way of life?

Answers

Answer:

Human activity, including irrigation practices, hydroelectric dams, and intense agricultural use, have led to desertification in the Sahel region. In addition, global warming has added to the problem. Over time, the soil becomes overused and sterile. As that dry and arid soil moves, it begins to encroach on local bodies of water. Lake Chad, as a result, has shrunk in size. Just 40 years ago, this lake contained 15,000 square miles of water. It now contains just over 500 square miles of water.

The locals of this region depend heavily on both fertile soil and healthy bodies of water for survival. Desertification can greatly endanger their way of life. For example, famers cannot produce the necessary crops, and fishers cannot rely on as much seafood. The article mentions that fishers who used to be able to fill hundreds of traps can now barely fill one. Desertification in the Sahel and its impact on Lake Chad will have a lasting effect and could possibly mean a different way of life for generations to come in the region.

Explanation:

The Sahel region's desertification is an issue as, without the roots of trees and other plants, the wind may easily sweep the dust away.

Due to these problems, water is now in short supply for local residents, animals, and plants. Farmers and herders are unable to continue living their traditional lifestyles without access to water and productive land.

How has desertification affected Lake Chad?

The "Basin" of Lake Chad, which makes up over 8% of the continent, is divided among seven nations: Algeria, Cameroon, Libya, Chad, Niger, and Nigeria. Due to overuse and the consequences of climate change, the water body has decreased by 90% since the 1960s.

As a result of desertification and climate change, which have reduced Lake Chad's surface area by 90% since 1960, the lake is gradually disappearing. The lake is located in the center of the humanitarian catastrophe brought on by the fight with the Boko Haram group's armed forces, making it dangerous to access what little is left.

The lake was formerly among the world's greatest bodies of water.

Learn more about desertification, from:

brainly.com/question/24255548

#SPJ2

Hydrostatic support describes _____.

the gravitational force of a star
the amount of light released from a star
the balance between gravity and pressure in a star
the actual brightness of a star when distance is not considered

Answers

the balance between gravity and pressure in a star

Answer:

the balance between gravity and pressure in a star

Explanation:

This is the correct answer because the definition of Hydrostatic is; I quote from the "Oxford Languages" is: relating to or denoting the equilibrium of liquids and the pressure exerted by liquid at rest.

The definition is very similar to the answer which makes the answer correct.

Hope I helped:)

Have a Great Day!!!

Communist Socialism in China led to...


a glorious "People's Paradise" in which workers shared labor, worked according to ability, and received according to need.

an end to wealthy elites and the privileged classes and social equality for all comrades.

rapid economic and agricultural growth, despite sacrifices that had to be made, for the "Good of the State."

privation and famine, mass-starvation, government brutality and mass executions, not that Mao cared.

Answers

Answer:

Option B

Explanation:

Communist Socialism was the emergence of socialism in China by bypassing capitalism.

It was marked by the down fall of rich elite class and emergence of socialist democracy and  socialist political civilization

Now there will be dominant state-owned enterprises sector along with the market capitalism and private ownership

hence, option B is correct

Other Questions
HELPP!!!!!!!!!!!!!!!! What transformation is shown below?reflectioncan't be determinedrotationtranslation In triangle ABC, angle A measures 50.5 degrees and angle B measures 74 degrees. What is the measure of angle C? DO NOT TRY TO PUT A DEGREE SIGN. JUST TYPE THE ANSWER!! - 1:Translate the following sequence into a short protein. Add hyphens between,please.235'- AUG GCA AAA GAG GAA CAU UAA - 3'56Second LetterUAGPheTyrSerUUUUUUCUUAUUGUCUUCCUCAUCGUAUUACUAAUAG39LeuStopStopUGUCys UUGCUGA Stop AUGG Trp GCGUCGCArgCGAGHisProCUUC | CCCUACUGCCULeu CCCCCACCGCAUCACCAACAGGin121st3rdCGGletterAsnSerlleAUUA AUCAUAAUGACUACCACAThrAAUAACAAAAAGAGUAGCAGAAGGU letterAG15Lys|ArgMet ACGAspGUUGGUCGUAGUGValAlaGCUGCCGCAGCGGAUGACGAAGAGGGUGGCGGAGGGGly|Duco18Gluhttp://biology.kenyon.edu/courses/biol114/Chap05/Chapter05.html1 Kailynn has been on a roll, and solving 5 math problems every 2.5 minutes. At this rae, how many problem will she solve in 30 minutes. What is the slope of the line in the graph? please help me with this please, this is due in a couple of minutes. Which states the best reason why Chapter 15 might be titled "Nest-Building"?The robin is building a nest in the garden.A nest is a symbol for a safe place where Mary and Colin can grow.The robins are a symbol for new life returning to the garden.Mary and Dickon want Colin to watch the robin building the nest. You estimate that there are 40 marbles in a jar. The actual amount is48 marbles. Find the percent error. Round to the nearest tenth of a percent. help me plz which formula should I use?? What is the pear harbor and what happened 1. When did Texas become a territory of the United States? 5 oranges are bought for $4.00 and later sold at $0.10 each .find the loss percent. What is an advantage to being ectothermic?Question 18 options:Ectothermic animals require much less energy to survive than endothermic animals. Ectothermic animals can sleep longer than endothermic animals. Ectothermic animals always live longer than endothermic animals. Ectothermic animals can live in a greater number of environments than endothermic animals. Why is it important for the brain to be so well protected? Bryson is painting kitchen stools. Each stool requires 1 1/2 liters of paint. Bryson has 20 liters of paint, How many stool will he be able to paint? En France, on sert toujours une salade verte au dbut d'un repas.TrueFalseNEXT QUESTIONASV COR irin How are ionic compounds named? What is the volume of the square pyramid ? Why didnt the Renaissance happen sooner?