Which statement is true about Alexander Fleming's initial understanding of penicillin?

A: He hoped that penicillin would cure certain diseases.

B: He was unaware that penicillin would have any effect.

C: He was sure penicillin would be a helpful medicine

D: He knew penicillin was deadly to some bacteria

Answers

Answer 1

Answer

B or A but im leaning towards B


Related Questions

THE LEGEND OF ROBIN HOOD: Consider what the sidebar "Medieval Society" says about the class system in England. How is this information reflected in the play? What other ideas about the class system are developed in the play? Explain.(theme, text features.) get brainly

Answers

Answer:

One of the most well-known philosophical plays of the twentieth century. ... “The toy industry is real science,” adds Georgia Van de Zande, a lecturer for the class. ... a theme for the discussion), but it was still good to see different businesses and ... he discovered his interest in the immune system, and made it his life's work.

Explanation:

WILL MARK BRANLIEST


Make an verbal expression from the equation 7(2j + 3 + 2j).

Answers

this has nothing to do with a question but if anybody’s looking at this question and you see the link that is pretty much on every single question do not click it it is a bot and it will track your IP STAY SAFE!!!!!!!

Answer:

28 + 21

HOPE THIS HELPS :)

In “Cub Pilot on the Mississippi,” George Ealer, the other pilot, is very
different from Brown. Which of the following words describes George Ealer?
a. lazy
b. unfair
c. forgetful
d. kindhearted

Answers

The answer is D. Kindhearted

How else could the 10 most common names in America have been illustrated? Select and explain an alternative way to illustrate the top 10 names. Your answer should be 2 to 3 sentences.

Answers

It could’ve been shown by ranking it from most common to least. This method would be easier for others to view it instead of having to see a bunch of bar graphs

If two’s company, and three’s a crowd, what are four and five?

Answers

Answer:

4 and 5 are just way too many where I'm not going because I can't stand that many people at one da-mn time..

Explanation:

four and five is nine

WILL GIVE BRALIST IF DONE CORRECTLY ( i really only need 4-5 sentences)

Write a short paragraph explaining how the theme developed in your story. Cite quotations and page numbers from your novel or short story to support your ideas.

Story: The Strangers That Came To Town

please help me it would really be apprciated <3

Answers

Answer:

I cant find the book sorry

Explanation:

Answer:

the book is unavalible

Explanation:

DEV/CC DBQ Essay: Are the Three Western Faiths more alike, or different?

Answers

Answer:

The three western religions are similar in many ways.

Explanation:

Which of these questions does a prepositional phrase answer?

who?

what?

where?

all of the above

Answers

Answer:

C) Where?

Explanation:

When used as an adverb, the prepositional phrase answers questions such as 'How? ', 'When? ' or 'Where? '

C is the answerrr:))

The following passage is from the end of “Cub Pilot on the Mississippi.” Why
does Twain make this statement?


During the brief remainder of the trip I knew how an emancipated slave feels, for I
was an emancipated slave myself.


a. Twain no longer has a conflict with the captain.
b. Twain has experienced a conflict with Brown.
c. Brown no longer can create conflicts with Twain.
d. Brown’s conflict with the captain has not been resolved.

Answers

Answer:

I do believe the answers be because of this how the slaves felt

Read this sentence from “Cub Pilot on the Mississippi.”

If I had two heads, I would have spoken; but as I had only one, it seemed judicious
to take care of it; so I kept still.


Based on the context, what does it mean if a person is judicious?


a. He or she is careful.
b. He or she is reckless.
c. He or she is thrilled.
d. He or she is nervous.

Answers

Answer: A

c:

hope i helped

Read this excerpt from The First Men in the Moon.
His mind ran on machines and invention, to the exclusion of a thousand dark things that beset me. It wasn't that he intended to make any use of these things, he simply wanted to know them. "After all," he said, "this is a tremendous occasion. It is the meeting of two worlds! What are we going to see? Think of what is below us here."

What is the author’s purpose in Mr. Bedford‘s description of Mr. Cavor above?
A) The author is revealing that Mr. Cavor’s desire to learn is more important to him than the danger he faces.
B) The author is contrasting the inventions on the moon to those on earth.
C) The author is signaling Mr. Cavor’s foolishness in ignoring Mr. Bedford’s warnings about the Selenites.
D) The author is creating tension between Mr. Bedford and Mr. Cavor.

Answers

Answer:

The author is revealing that Mr. Cavor's desire to learn is more important to him than the danger he faces.

Explanation:

I think it’s A but I could be wrong

How do you fix sentence fragments? Select all that apply.

A. by making the sentence a complete thought
B. by adding a subject
C. by adding a verb
D. by adding an adjective

Answers

Answer:

A. By making the sentence a complete thought.

Answer:

BY MAKING THE SENTENCE A COMPLETE THOUGHT I HAVE THAT QUESTION

Explanation:

What kind of coat is best put on wet?

i will tell you if youre right, but if no one gets it then i will tell you the answer

who ever gets it right will be the brainest

Good luck!

Answers

A coat of paint I think??

A bucket of paint I think

Over activating the reward system of the brain can result in all of the following except....

A. loss of control
B. craving
C. increase tolerance to sugar
D. better grades

Answers

d. better grades yeaaaa
the answer should come out to be D

Which sentence best states Nhamo’s feelings about home in “The Setting Sun
and the Rolling World”?
a. It is too hot and noisy.
b. It is a place without love.
c. It is charming but boring.
d. It is a place with no future

Answers

Answer:i’m pretty sure it’s “B”

Explanation:

I think it’s the answer is B

PLWESSS HELPPP
An optical illusion is a trick that relies on which of the five senses?
touch
smell
sight
sound

Answers

Answer: Sight

Explanation:

The answer will be sight

1.
Which sentence supports the claim, bedbugs have become one of the most dreaded and expensive pests around?

Ridding a house of bedbugs can easily cost $5,000.

When a bedbug bites a human, the human doesn’t feel it.

Bedbugs are hard to find during the daytime.

You may have bedbugs if you wake up with a rash.

Answers

The answer would be
A-ridding a house of bedbugs would cosh 5,000 cause that’s the only won about money and it shows it would cost a lot of money!

Answer:

It's A, "Ridding a house of bedbugs can easily cost $50,000"

Explanation:

$50,000 meets the expensive part, and  bedbugs are probably dreaded because of that cost.

How would a conclusion be written if I had to write an essay that went like this: "Based on info in "types of caves", decide what cave Solada, Taye, and Quinn probably explore in "lost in a cave!" Support your answer with details, evidence, and facts from both passages. Your answer should be at least 3 paragraphs long."?
Please help if two people answer I will give brainliest.

Answers

Answer:

It would go something like this

In conclusion, Solada, Taye, and Quinn explore [your answer here], [another answer (Optional) ], and [last answer, (optional)]; based on the information from "Types of caves".

Here is a book www.typesofcaves.com

Quick Trivia: What Do You Call A Turtle Under The Ground

The Right Answer Will Get Brainllest

Answers

Answer:

A tortoise?

Explanation:

Instead, a universal theme is one that _______________________________

Answers

Answer:

a central idea

Explanation:

a theme that applies to everyone in general for all different central sencerais

A central idea is a theme of what it’s going to happen

Which sentence would be the best re-statement of this paragraph from the article “Those Mysterious Comets”?

Because comets are made of water and dust, they reflect light well. This means you can see some comets very easily. But scientists only know about comets that make regular appearances. This means that most comets have not been discovered yet. Scientists rely on people who watch the skies regularly to report new comets.

There are no new comets to be found today.
Comets can be seen easily, and ordinary people can help scientists spot them.
Comets are made of water and dust.
Only scientists using strong telescopes can identify new comets

Answers

Answer:Because comets are made of water and dust, they reflect light well. This means you can see some comets very easily. 

Explanation:

The word phobia means “to fear”. Combined with other prefix words, we can tell what fears someone might have. For example: arachnophobia is a fear of spiders, coulrophobia is a fear of clowns, and monophobia is a fear of being alone. What fears do you have? Why do you have these fears? What ways could you think of to rid yourself of these fears? Please write a 7 sentence paragraph.

Answers

Answer: Whatever it is that scares you, here are 10 ways to help you cope with your day-to-day fears and anxieties.

These tips are for people who are coping with everyday fears. If you have been diagnosed with an anxiety-related condition, see our page on generalized anxiety disorder.

1. Take time out

It's impossible to think clearly when you're flooded with fear or anxiety. The first thing to do is take time out so you can physically calm down.

Distract yourself from the worry for 15 minutes by walking around the block, making a cup of tea or having a bath.

2. Breathe through panic

If you start to get a faster heartbeat or sweating palms, the best thing is not to fight it.

Stay where you are and simply feel the panic without trying to distract yourself. Place the palm of your hand on your stomach and breathe slowly and deeply.

The goal is to help the mind get used to coping with panic, which takes the fear of fear away.

Try this breathing technique for stress

3. Face your fears

Avoiding fears only makes them scarier. Whatever your fear, if you face it, it should start to fade. If you panic one day getting into a lift, for example, it's best to get back into a lift the next day.

4. Imagine the worst

Try imagining the worst thing that can happen – perhaps it's panicking and having a heart attack. Then try to think yourself into having a heart attack. It's just not possible. The fear will run away the more you chase it.

5. Look at the evidence

It sometimes helps to challenge fearful thoughts. For example, if you're scared of getting trapped in a lift and suffocating, ask yourself if you have ever heard of this happening to someone. Ask yourself what you would say to a friend who had a similar fear.

6. Don't try to be perfect

Life is full of stresses, yet many of us feel that our lives must be perfect. Bad days and setbacks will always happen, and it's important to remember that life is messy.

7. Visualise a happy place

Take a moment to close your eyes and imagine a place of safety and calm. It could be a picture of you walking on a beautiful beach, or snuggled up in bed with the cat next to you, or a happy memory from childhood. Let the positive feelings soothe you until you feel more relaxed.

8. Talk about it

Sharing fears takes away a lot of their scariness. If you can't talk to a partner, friend or family member, call a helpline such as Breathing Space on 0800 83 85 87 or Samaritans on 116 123.

You could also try a Cognitive Behavioural Therapy approach over the telephone, with a service such as NHS Living Life. If you would like to find out more about this appointment-based service, you can visit the Living Life website or phone 0800 328 9655 (Mon to Fri, 1pm to 9pm).​

If your fears aren't going away, you can ask your GP for help. GPs can refer people for counselling, psychotherapy or help through an online mental health service, such as Living Life to the Full.

9. Go back to basics

Lots of people turn to alcohol or drugs to self-treat anxiety, but this will only make matters worse. Simple, everyday things like a good night's sleep, a wholesome meal and a walk are often the best cures for anxiety.

10. Reward yourself

Finally, give yourself a treat. When you've made that call you've been dreading, for example, reinforce your success by treating yourself to a massage, a country walk, a meal out, a book, a DVD, or whatever little gift makes you happy.

Explanation:

Part A

Which word is most clearly opposite in meaning to the word
malicious as it is used in this quotation from “Cub Pilot on the Mississippi”?
Choose the opposite based on context clues in the passage.
He was a middle-aged, long, slim, bony, smooth-shaven, horse-faced, ignorant,
stingy, malicious, snarling, fault hunting, mote-magnifying tyrant.
a. kind
b. funny
c. cruel
d. sarcastic

Answers

Answer A : Kind

The word malicious means mean , unpleasant so kind is the only answer that works

A is the answer to this question

40 POINTS WILL GIVE BRAINLIEST TO BEST ANSWER NO LINKS
Write a summary for The Secret Garden. I need this before 3:30
Please don't put links

Answers

Answer:

The novel centers on Mary Lennox, who is living in India with her wealthy British family. She is a selfish and disagreeable 10-year-old girl who has been spoiled by her servants and neglected by her unloving parents. When a cholera epidemic kills her parents and the servants, Mary is orphaned.

Explanation:

The Secret Garden is a charming book about a girl named Mary Lennox. She is a spoiled and lucky child who lives in India. When her parents die due to a cholera epidemic, she moves to Misselthwaite Manor to live with her rich uncle in England. Mary begins to explore the grounds and takes an interest in the outdoors. As Mary forms new friendships, she continues to learn the magic of her surroundings.

hope this helps...

have a great weekend! ( ̄▽ ̄)ノ

Read the following passage and identify type of supporting evidence used:

Our guides, Andrew and Claire, were experts on reef life. "Swim slowly and silently to see lots of fish," they said. (Loewen, paragraph 3)


details
facts
examples
quotes

Answers

Answer:

quotes is the answer...

pls help me i need it i will give branlest (OR) cash on cash app

What is an adaptation?
an animal’s reason for preferring a particular habitat
when an animal in one species adopts an animal from another species
a physical or behavior change for the purpose of survival
a species that is about to go extinct

Answers

The answer is a physical or behavior change for the purpose of survival
if physical or behavior change for the purpose of survival.

What does docile mean?

will give brainliest

Answers

Answer:

ready to accept control or instruction; submissive.

Explanation:

Example: a cheap and docile workforce

Answer:

It kind of means weak, submissive, gentle, and obedient.

Explanation:

When you read a play, how do you know what the actors are supposed to do?

A. by reading the cast of characters
B. by reading the stage directions
C. by reading the actors words

Answers

Answer:

by reading the cast character

Answer: B

Explanation:

After there was a ___________ between the two dogs, one of them was left with a bite wound on his leg.

Answers

Answer:

Fray

Fray - a situation of intense competitive activity

Explanation:

After there was a fray between the two dogs, one of them was left with a bite wound on his leg.

The storm came out of nowhere, it seemed. Sally rushed to find shelter off of the street. She found herself under the overhang of a convenience store. As she wiped the water out of her eyes, she noticed a nice-looking gentleman standing next to her. They began to talk about the storm, about New York, about fate. Soon, Sally had a date with the handsome man. Her new suede shoes were ruined, but it was worth it! What a fabulous storm! Which text structure did the writer mainly use to develop this passage? A. question and answer B. problem and solution C. compare and contrast D. cause and effect

Answers

Answer: D

Explanation:

D is right I have done this on before.
Other Questions
help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks. If 2 cups makes 6 servings, how much makes 2 servings? shawtys been simping for so long.. do you think hunter-gatherers are still around today? what makes you think that? Hi, I am very stuck on questions 17 and 18. Can someone help please? Thanks In which quadrant does the point with c ordinate (4, -3) lie? Which student has the greater median test score? I have to study for a test. It's for data management. Does anyone have tips? (Grade 7)