Which process of genetic recombination involves genes from both parents?
crossing over
independent assortment
fertilization
tetrad formation

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

Answer: down

Explanation: bio teacher here

Answer:

GL Gl gL gl

Explanation:

Answer:

Inputs---- glucose and oxygen.

Outputs----- ATP, carbondioxide and water.

Explanation:

The inputs of cellular respiration are the glucose and oxygen whereas the outputs of cellular respiration are energy in the form of ATP, carbondioxide gas and water. cellular respiration is a process in which glucose is broken down in the presence of oxygen gas for the production of energy in the form of ATP molecules. Carbondioxide gas and water which are the waste materials also produced in the end of cellular respiration process. Cellular respiration is the reverse of photosynthesis.

Mendel's dihybrid cross proves that the inheritance of one trait does not affect the inheritance of another trait. Hence, option 4 is correct.

When two different traits are crossed together then it is called a dihybrid cross. These two different traits are regulated by two different genes.

In Mendel's dihybrid cross, he did cross between round yellow and wrinkled grees. There are two traits, color, and shape. In the F1 generation, all seeds were round yellow but they were heterozygous. Round shape and yellow color are dominant traits.

Then he self-pollinated F2 generation and found four types of seeds that were round yellow, round green, wrinkled yellow, and wrinkled green in the 9:3:3:1 ratio. The cross is attached in the image below.

Inheritance of one trait does not affect the inheritance of another trait. Hence, option 4 is correct.

Learn more about dihybrid cross, here:

https://brainly.com/question/12540319

#SPJ2

Answer:

I believe the answer is C.

Explanation:

Formula is Glucose + 6 Oxygen makes energy, 6 carbon dioxide molecules and 6 water molecules.

Answer:

Answer is in explanation

Explanation:

A silent mutation is a mutation in which a single nucleotide base is changed, but that change does not effect the amino acid sequence. A missense mutation is a point mutation in which a single nucleotide is changed, resulting in a codon that codes for a different amino acid.

The mutation is caused by the exchange of one base pair if no change in the overall protein (silence mutation),  if there is change in one amino acid (missense mutation).

A mutation is a difference in the DNA sequence of an organism.

Silent mutations happen when the difference of a single DNA nucleotide within a protein-coding portion of a gene does not influence the sequence of amino acids and the protein.

Thus, silent mutation has no change whereas stop mutation leads to termination of protein.

To learn more about mutation click here:

https://brainly.com/question/13923224

Answer:

shorter limbs would be the best characteristic to confirm

Explanation:

Answer:

A

Explanation:

Because it is way more logic

Answer:

Unlike a lytic virus, a lysogenic virus does not cause the host cell to lyse away. A lysogenic virus can remain inactive for a period of time. In lysogenic infection, viral DNA gets integrated with the host cell's DNA, where it is copied along with the host cell's DNA when the host cell replicates.

Explanation:

Answer:

D. 367

Explanation:

If a roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates, it contains 367 calories of energy, hence option D is correct.

Animals obtain the chemical energy known as "food energy" from their food in order to maintain their metabolism, which includes their muscular activity.

The majority of animals get most of their energy via aerobic respiration, which involves mixing carbs, lipids, and proteins with air or water-based oxygen.

To find the total calories, multiply the given biomolecules grams with their calorie count.

= 42 × 4 + 7 × 9 + 34 × 4

= 168 + 63 + 136

= 367 calories

Therefore, the sandwich provides 367 calories of energy, if it contains 42 g protein, 7 g fat, and 34 g carbohydrates.

Learn more about energy, here:

https://brainly.com/question/839331

#SPJ5

Answer:yes the car is stuck so yes he was in the car and he can’t get out

Explanation:

Answer:

sddssa

Explanation:sa

[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]

E. NADPH

Answer:

E

Explanation:

it enters the citric acid cycle and generates reducing equivalents in the form of NADPH

Biodiversity contributes to the sustainability of an ecosystem in ways such as biodiversity, ecosystem stability, ecosystem resilience, nutrient cycling, pollination, and medicinal properties.

Biodiversity is crucial for the sustainability of an ecosystem as it plays a significant role in maintaining the functioning of ecosystems and providing a range of ecological services. In tropical rainforests, which have the highest biodiversity, the presence of numerous species of plants, animals, fungi, and microorganisms contributes to the sustainability of the ecosystem in the following ways:

Ecosystem Stability: Biodiversity helps to maintain the stability of an ecosystem by providing a balance between predator and prey populations, nutrient cycling, and decomposition.

Ecosystem Resilience: The greater the biodiversity of an ecosystem, the more resilient it is to disturbances such as climate change, natural disasters, and human activities.

Nutrient Cycling: Biodiversity helps in the efficient cycling of nutrients in the ecosystem. Different species of plants and microorganisms play a role in decomposing organic matter, recycling nutrients, and maintaining soil fertility.

In summary, biodiversity is essential for the sustainability of ecosystems. It provides ecological services that are critical for maintaining the functioning of the ecosystem and contributing to human well-being.

To learn more about Biodiversity here

https://brainly.com/question/29765125

#SPJ1

Answer:

Panax ginseng (Chinese or Korean ginseng) has been shown to have similar properties under certain circumstances. McNaughton et al., 1989 noted increases in pectoral strength, quadriceps strength, and post-exercise recovery following dietary supplementation with ginseng root powder.

Explanation:

Answer:

False

Explanation:

An organism's niche includes its environment, behaviors, and interactions. It also includes its role within the environment. The environment consists of living and nonliving components.

Answer:

B

Explanation:

Answer:

Duck-billed platypus

Explanation:

The duck-billed platypus is the only mammal that lays eggs.

Answer:

In the adult organism, mitosis plays a role in cell replacement, wound healing and tumour formation. Mitosis, although a continuous process, is conventionally divided into five stages: prophase, prometaphase, metaphase, anaphase and telophase.

Cell cycle has different stages called G1, S, G2, and M. G1 is the stage where the cell is preparing to divide. To do this, it then moves into the S phase where the cell copies all the DNA.

Explanation:

good luck

please mark me as a brainliest

Answer:

It allows the scientists to activate gene expression instead of cutting the DNA.

Explanation:

The development of CRISPR-Cas9 is significant for the scientific community because this development allows the scientists to activate gene expression instead of cutting the DNA. This technique allows the scientists and researchers to study the function of the gene. Before development, Cas9 enzymes produced by the CRISPR system binds to the DNA and cuts it by shutting the targeted gene off so this development of CRISPR-Cas9 enables the scientists to activate gene expression instead of cutting the DNA.

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Answer:

I'm pretty sure it would be c

Explanation:

because it is a star so it definitely is not a or d and I don't think it is rocky soooo

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

Answer:

Producer

Explanation:

I think it should be producer.

Answer:

Producer

Explanation:

The 1st organism in a food chain must always be what type of organism?

Producer