Which of these groups of fruits are drupes? Pineapples, mulberries, and figs Oranges, lemons, and limes Plums, apricots, and coconuts Strawberries, blackberries, and raspberries Apples, pears, and quinces

Answers

Answer 1

Drupes are a special group of fruits that have a hard outer layer (exocarp) and a fleshy inner layer (mesocarp). The mesocarp encloses a single hard seed. Plums, apricots, and coconuts are all drupes.

Here, correct option is C.

Plums have a single hard seed surrounded by a fleshy inner layer, while apricots and coconuts each have one or two hard seeds surrounded by a fleshy inner layer. Pineapples, mulberries, and figs are also drupes, with pineapples having a single hard seed and figs having several hard seeds surrounded by a fleshy inner layer.

Oranges, lemons, and limes are not drupes as they do not have a single hard seed surrounded by a fleshy inner layer. Strawberries, blackberries, and raspberries are also not drupes as they do not have a single hard seed surrounded by a fleshy inner layer.

Therefore, correct option is C.

know more about Drupes here

https://brainly.com/question/31178343#

#SPJ11

complete question is :

Which of these groups of fruits are drupes?

A. Pineapples, mulberries, and figs Oranges,

B. lemons, and limes

C. Plums, apricots, and coconuts

D. Strawberries, blackberries, and raspberries

E. Apples, pears, and quinces


Related Questions

Which two viral characteristics provide evidence to support the



argument that viruses are more similar to living components than to



nonliving components of an ecosystem?




A. Viruses contain genetic material.




B. Viruses are made of cells.




c. Viruses use and store energy to grow.




D. Viruses reproduce independently.




E. Viruses evolve through mutation and natural selection

Answers

Viruses share several characteristics with living organisms, such as containing genetic material, being made of cells, using and storing energy to grow, reproducing independently, and evolving through mutation and natural selection.

Here, all the options are correct.

This evidence reveals that viruses are capable of many of the same functions as living organisms. For example, viruses use and store energy to power their growth and evolution, just like living organisms. They also possess genetic material and can reproduce independently, which is a trait shared by all living organisms.

Additionally, viruses can mutate and evolve, which is a necessary component for the continued survival of any species. These evidence-based characteristics demonstrate that viruses are more similar to living components than to nonliving components of an ecosystem.

Therefore, all the options are correct.

Know more about Viruses here

https://brainly.com/question/30972422#

#SPJ11

Which structure serves to increase the speed with which a signal travels within a neuron?.

Answers

The structure that serves to increase the speed with which a signal travels within a neuron is called the myelin sheath.

The myelin sheath is a layer of insulation that surrounds the axon of a neuron and helps to speed up the transmission of electrical signals (or action potentials) along the axon.

The myelin sheath is made up of specialized cells called glial cells (oligodendrocytes in the central nervous system and Schwann cells in the peripheral nervous system) that wrap themselves around the axon, leaving small gaps or nodes of Ranvier between them.

These nodes allow the electrical signal to jump quickly from one node to the next, resulting in faster conduction of the signal.

To know more about the myelin sheath refer here :

https://brainly.com/question/14895639#

#SPJ11

which of the options is not a general requirement for complex multicellular life? cells must communicate with one another. cells must participate in a network of genetic interactions that regulate cell division. cells must stick together. all of these choices are correct. individual cells must retain a full range of functions, including reproduction.

Answers

The option that is not a general requirement for complex multicellular life is (e)."individual cells must retain a full range of functions, including reproduction." is correct option.

In fact, in complex multicellular organisms, cells specialize and differentiate into various types with specific functions, and reproduction is often performed by specialized cells or structures. The other three options, namely, cells must communicate with one another, cells must participate in a network of genetic interactions that regulate cell division, and cells must stick together are all essential requirements for complex multicellular life.

Therefore, the correct option is (e).

To know more about multicellular

https://brainly.com/question/9984107

#SPJ4

Why does an action potential travel in one direction down an axon?.

Answers

An action potential is an electrical signal that travels down the axon of a neuron. One of the key features of an action potential is that it travels in one direction only, from the cell body of the neuron to its axon terminal.

This directional flow of the action potential is due to the refractory period of the neuron. After an action potential is fired, the neuron enters a brief refractory period during which it is unable to generate another action potential in the same direction.

This refractory period ensures that the action potential moves only in one direction, preventing the signal from moving backward and interfering with other signals in the nervous system.

To know more about the action potential refer here :

https://brainly.com/question/30701189#

#SPJ11

in addition to carbon dioxide and water state two other conditions necessary for photosynthesis

Answers

Answer:

sunlight and chlorophyll

Explanation:

these two conditions must be present with water and carbon dioxide for photosynthesis to take place in plant organisms

hope this helps! :)

Answer:

Sunlight and chlorophyll must be present along with the carbon dioxide and water for the process of photosynthesis to take place in plants.

Hope this helps :)

Pls brainliest...

What type of succession would occur after a glacier moved and uncovered new land?.

Answers

The type of succession that would occur after a glacier moved and uncovered new land is called primary succession. Primary succession is the process of plant and animal colonization of an area that has never before supported life.

In the case of a glacier retreat, the exposed land is typically barren and devoid of life, with no pre-existing soil.  In the early stages of primary succession, lichens and mosses are typically the first organisms to colonize the area.

These pioneer species help to break down rock and other materials, creating soil over time. As the soil deepens, larger and more complex plants can establish themselves. Eventually, a diverse community of plants and animals will develop, forming a stable ecosystem.

To know more about the primary succession refer here :

https://brainly.com/question/1387957#

#SPJ11

Which is a consequence of global warming?cooling oceansgrowing glaciersless frequent hurricanesrising sea levels

Answers

The consequence of global warming is rising sea levels.

As the Earth's temperature increases due to the accumulation of greenhouse gases in the atmosphere, the melting of ice sheets and glaciers causes the sea levels to rise.

This rise in sea levels can lead to increased flooding, erosion, and loss of habitat for coastal ecosystems and wildlife. Additionally, as sea levels rise, saltwater intrusion can occur in coastal aquifers, affecting freshwater resources.

The increase in temperature can also cause changes in ocean currents and weather patterns, leading to more frequent and intense hurricanes, typhoons, and cyclones. It is crucial to reduce greenhouse gas emissions and implement measures to adapt to the impacts of global warming to prevent further damage to the Earth's ecosystems and the well-being of its inhabitants.

To know more about global warming, refer here:

https://brainly.com/question/3553382#

#SPJ11

How is antigenic drift beneficial for viruses?
*
1 point
It changes how genes code for antigens.
It creates a variety of immune responses in the host organisms.
It leads to less mRNA which is easier to copy.
It makes them unrecognizable to the immune system.

Answers

Answer: D

It makes them unrecognizable to the immune system.

Explanation:

Will have a harder time recognizing and fighting against the virus.

Not sure if it's right. Let me know if it is.

ovulation begins when a mature egg(ovum) is released from an ovary. peristaltic contractions and the action of cilia transport the ovum through the fallopian tube to the uterus. the hormones estrogen, follicle-stimulating hormone (fsh), luteinizing hormone, and progesterone regulate and control this process. reading this senario which body systems interact with eachother

Answers

The scenario described involves the interaction of several body systems to facilitate ovulation and fertilization, with the ovaries releasing the mature egg and the fallopian tubes and uterus providing the necessary environment for fertilization and implantation.

Hormones play a crucial role in regulating the reproductive system. Estrogen and progesterone, produced by the ovaries, help to prepare the uterus for implantation and maintain the pregnancy. Follicle-stimulating hormone (FSH) and luteinizing hormone (LH) are produced by the pituitary gland and are responsible for regulating ovulation and the menstrual cycle.

The nervous system also plays a role in the process of ovulation, with signals from the brain triggering the release of hormones from the pituitary gland. The muscular system is also involved, with peristaltic contractions and ciliary action helping to move the ovum through the fallopian tube.

To learn more about ovaries follow the link:

https://brainly.com/question/27641061

#SPJ1

Where would you expect to find a convection current that occurs between land and water?

Answers

Answer:The Earth's mantle

Explanation:

Why is the energy source for active nuclei like seyferts thought to be compact?.

Answers

The energy source for active nuclei like Seyferts is thought to be compact because of the high luminosity and rapid variability of their emission.

Seyfert galaxies are a type of active galactic nucleus (AGN) characterized by strong and variable emission lines. It is believed that the energy source for Seyferts is a supermassive black hole at the center of the galaxy.

The high luminosity of Seyfert nuclei suggests that a large amount of energy is being released in a small volume, which is why the energy source is thought to be compact. In addition, the rapid variability of the emission lines indicates that the energy source is small and rapidly changing, consistent with a compact object like a black hole.

Observations have confirmed the presence of supermassive black holes at the centers of many Seyfert galaxies, providing strong evidence for the compact energy source hypothesis.

To know more about the Seyfert galaxies refer here :

https://brainly.com/question/31465601#

#SPJ11

big bend national park in west texas is mostly desert, where rainfall averages only about 25 centimeters per year. yet, it is not uncommon when hiking in this extremely arid zone to encounter mosses and ferns in certain areas. what adaptive characteristics of both mosses and ferns makes it possible that they can survive for many generations in dry deserts when water becomes infrequently available?

Answers

Based on these additional observations the “flower of stone" are inferred as it is a fern and the cone-like structures are sori, the correct option is B.

The presence of cone-like structures emitting spores of two different sizes is a characteristic feature of ferns, and these structures are called sori. Therefore, it can be inferred that the "flower of stone" is a fern.

Additionally, the fact that the plant does not produce seeds but reproduces through spores further supports the inference that it is a fern. The Y-shaped structure of the roots branching only at the growing tip is a characteristic feature of ferns as well, the correct option is B.

To learn more about sori follow the link:

https://brainly.com/question/3456169

#SPJ4

The complete question is:

Big Bend National Park in Texas is mostly Chihuahuan desert, where rainfall averages about 25 centimeters per year. Yet, it is not uncommon when hiking in this extremely arid zone to encounter mosses and ferns. One such plant is called the "flower of stone." It is not a flowering plant, nor does it produce seeds. Under arid conditions, its leaflike structures curl up. However, when it rains, it unfurls its leaves, which form a bright green rosette on the desert floor. Consequently, it is sometimes called the "resurrection plant." At first glance, it could be a fern, a true moss, or a spike mosS Upon closer inspection of the leaves of "lower of stone," one can observe tiny, cone-like structures. Each cone-like structure emits spores of two different sizes. Further investigation also reveals that the roots of the "flower of stone" branch only at the growing tip of the root, forming a Y-shaped structure. Based on these additional observations, which of the following can be properly inferred about the "flower of stone"?

A) It is heterosporous and has separate male and female gametophytes.

B) It is a fern and the cone-like structures are sori.

C) It is heterosporous, it is a fern, and the cone-like structures are sori.

D) It is heterosporous, it is a lycophyte, and it has separate male and female gametophytes.

At the end of _____ and cytokinesis, haploid cells contain chromosomes that each consist of two sister chromatids. at the end of _____ and cytokinesis, haploid cells contain chromosomes that each consist of two sister chromatids. interphase metaphase ii telophase i telophase ii telophase submit

Answers

At the end of meiosis II and cytokinesis, haploid cells contain chromosomes that each consist of two sister chromatids. Meiosis II is the second division of meiosis and it follows meiosis I. During meiosis II, the two sister chromatids of each chromosome are separated from each other, resulting in the production of haploid daughter cells.

The process of meiosis involves two rounds of cell division, each consisting of different stages. In meiosis I, the homologous chromosomes pair up and exchange genetic material in a process called crossing over. The chromosomes are then separated, resulting in the production of two haploid daughter cells that each contain a mix of genetic material from both parents.

In meiosis II, the sister chromatids of each chromosome are separated from each other. This results in the production of four haploid daughter cells, each containing a single set of chromosomes that each consist of two sister chromatids. These haploid daughter cells can then go on to participate in sexual reproduction, combining with another haploid cell to form a new, genetically diverse individual.

To know more about cytokinesis click here:

https://brainly.com/question/10606931

#SPJ11

Final answer:

At the end of Telophase I and cytokinesis, haploid cells contain chromosomes that each consist of two sister chromatids. At the end of Telophase II and cytokinesis, haploid cells contain chromosomes that each exist independently.

Explanation:

The question is asking about the specific stages in meiosis where haploid cells contain chromosomes that each consist of two sister chromatids. At the end of Telophase I and cytokinesis, haploid cells contain chromosomes that each consist of two sister chromatids. This happens because during Telophase I, chromosome pairs reach the poles of the cell, and the cytoplasm divides. Each resulting haploid cell, therefore, has the half number of chromosomes, and each chromosome consists of two sister chromatids. On the other hand, at the end of Telophase II and cytokinesis, haploid cells contain chromosomes that each exist independently, not as sister chromatids, because during Anaphase II, the sister chromatids separate.

Learn more about Meiosis here:

https://brainly.com/question/32192580

#SPJ12

Jackson creates the model shown in the diagram. He forms a clay mountain at the bottom of a plastic container and adds water to the container. Jackson then places a lid on top of the container and a petri dish filled with ice cubes on top of the lid. Next, he places a lamp over the container and turns it on.

a. What observation would indicate to Jackson that water is being cycled within the model?

b. Explain why the observation is evidence that water is being cycled within the model.

Answers

a. Jackson would observe condensation on the lid of the container.

b. The observation of condensation on the lid of the container is evidence that water is being cycled within the model. When the lamp heats up the water in the container, the water evaporates and rises up to the cooler lid where it condenses and forms droplets. These droplets then fall back into the container, completing the cycle of evaporation, condensation, and precipitation. This process mimics the natural water cycle on Earth where water evaporates from oceans and other bodies of water, forms clouds, and then falls back to Earth as precipitation.

The karyotype of a trisomic individual is symbolized as ____.

Answers

Answer:

2n+1.

Explanation:

The karotype of a trisomic individual is symbolized as 2n+1.

Discuss how human impact on the environment that could lead to a change in an organism's dna and alter the growth and reproduction of individuals. please provide an example of an organism.

Answers

Answer:

A human impact such as increased land use can lead to changes in different organisms DNA. As we take up more space and destroy increasing numbers of habitats to build infrastructure and places to live for the growing population, organisms are forced to relocate to new habitats and ecosystems. Because of this, there organisms are introduced to a new food web, which can alter how they interact with their environment. If they are competing with another breed of animal who is able to obtain a certain food source and they are not because of a certain feature on their bodies, throughout the process of evolution they could develop that trait that they were missing previously and become more equal on the playing field with the species that had been there long before them.

there are two forms of human earwax: wet and dry. w is a dominant allele that produces wet earwax. individual 1 has dry ear wax and 2 has wet earwax. what is the probability that an offspring of ii-1 and ii-2 has dry ear wax? a. 1% b. 5% c. 9% d. 10%

Answers

There are two forms of human earwax: wet and dry. w is a dominant allele that produces wet earwax (b).5% is correct option.

Since individual 1 has dry ear wax, we can infer that they are homozygous recessive (ww). Individual 2 has wet earwax, so they must be either homozygous dominant (WW) or heterozygous (Ww).

Each box in the Punnett square represents a possible offspring genotype, with the corresponding phenotype shown below it. We can see that there is a 50% chance that the offspring will inherit a recessive w allele from each parent and therefore have dry ear wax.

Therefore, the probability of the offspring having dry earwax is 50%, which is answer choice (b) 5%.

To know more about earwax

https://brainly.com/question/30824700

#SPJ4

Would samples that were digested with ecori have a different pattern than the same sample digested with smal?

Answers

Yes, samples that were digested with EcoRI would have a different pattern than the same sample digested with SmaI.

This is because EcoRI and SmaI are two different restriction endonucleases, which are enzymes that have the ability to cut DNA at specific sites. The DNA substrate of EcoRI has a recognition sequence of GAATTC, meaning that the enzyme will recognize and cleave the phosphodiester bond located between the G and A bases.

On the other hand, SmaI's recognition sequence is CCCGGG, meaning that the enzyme will recognize and cleave the phosphodiester bond located between the C and G bases. Therefore, EcoRI and SmaI will both recognize different sequences in the same sample and consequently cut the DNA in different places, resulting in a different pattern after digestion.

know more about restriction endonucleases here

https://brainly.com/question/31681326#

#SPJ11

Question 9 (1 point)


Choose ALL that apply for raft spiders.


Raft spider sight weight and large surface area allow it to walk on water.


Raft spider's heavy weight and small surface area allow it to walk on water


Raft spiders sprint along submerged plants to catch underwater prey.


Raft spider's legs have a waxy surface that repels water


Cortion 11

Answers

Raft spiders, also known as fishing spiders, are fascinating creatures that inhabit wetland habitats throughout the world. The correct option is A. Raft spider sight weight and large surface area allow it to walk on water.

C: Raft spiders sprint along submerged plants to catch underwater prey.

D. Raft spider's legs have a waxy surface that repels water

These spiders are unique in that they have evolved to sprint along submerged plants in order to catch their underwater prey. This incredible ability allows them to move quickly and efficiently across the water's surface, making them one of the most successful predators in their environment.

Raft spiders are well adapted to life in wetlands and have a number of unique adaptations that allow them to survive in this challenging environment. They have large, flat legs that enable them to move quickly across the water's surface without sinking. They also have specialized hairs on their legs that allow them to detect the slightest movements in the water, helping them to locate prey.

One of the most interesting things about raft spiders is their hunting strategy. These spiders use a combination of speed and stealth to catch their prey. They sprint along the surface of the water, using their specialized hairs to detect the movements of potential prey. Once they have located their target, they pounce on it with lightning speed, using their powerful jaws to immobilize it.

Overall, raft spiders are fascinating creatures that have evolved unique adaptations to help them survive in their watery world. Their ability to sprint along submerged plants and catch underwater prey is truly remarkable and makes them one of the most impressive predators in the animal kingdom.

To know more about Raft spiders click here:

https://brainly.com/question/27790797

#SPJ11

1. The pyramid shown represents a single food chain in an ecosystem. What happens to the energy as it moves from one trophic level to the next?

2. Why is a pyramid like the one shown a good representation of the energy in a food chain?

Answers

A pyramid of energy is a useful tool for understanding the flow of energy through an ecosystem and the efficiency of energy transfer between trophic levels.

What happens to energy in a food pyramid?

As the energy moves from one trophic level to the next in a food chain, it decreases. This is because only a fraction of the energy that is consumed by organisms at each trophic level is passed on to the next level. This fraction is typically around 10%, with the remaining energy being lost as heat or used for metabolic processes.

A pyramid like the one shown is a good representation of the energy in a food chain because it illustrates the decreasing amount of energy available at each successive trophic level. The base of the pyramid represents the primary producers, which have the most energy available to them.

As the energy is transferred up the pyramid to higher trophic levels, the amount of energy available decreases, resulting in a smaller biomass at each level.

Learn more about a food pyramid at: https://brainly.com/question/26876911

#SPJ1

In this relationship the barnacles Drive benefit there’s no benefit of this relationship is an example of

Answers

The statement "In this relationship, the barnacles drive benefit; there’s no benefit of this relationship" is an example of commensalism.

Commensalism is a type of symbiotic relationship between two organisms in which one organism benefits while the other is not affected either positively or negatively.

In this relationship, the barnacles are the beneficiary organism while the other organism is neither helped nor harmed.

Barnacles are often found attached to the surface of whales, turtles, and other marine animals. The barnacles gain a habitat and protection from predators by attaching themselves to these animals.

Meanwhile, the host animals are neither helped nor harmed by the barnacles' presence. This relationship is an example of commensalism since only one organism is benefited while the other is unaffected.

Commensalism is one of the three types of symbiotic relationships, along with mutualism and parasitism. Mutualism benefits both organisms, while parasitism benefits one organism at the expense of the other.

To know more about "Commensalism" refer here:

https://brainly.com/question/20041982#

#SPJ11

A greater concentration of substances in urine (e.g., glucose or protein) would cause the urine to have a(n) __________ specific gravity than water.

Answers

A greater concentration of substances in urine such as glucose or protein would cause the urine to have a higher specific gravity than water.

The specific gravity of urine reflects the density of particles in the urine sample. Water has a specific gravity of 1.000, while urine typically has a specific gravity ranging from 1.003 to 1.035. This variation in specific gravity is due to the varying concentration of solutes in the urine. If the urine contains higher amounts of glucose or protein, the specific gravity will be higher, indicating that the urine is more concentrated than water.

Elevated levels of glucose or protein in urine may indicate underlying health conditions such as diabetes or kidney disease. Regular monitoring of specific gravity can provide valuable information about kidney function and overall health. In summary, a greater concentration of substances in urine would result in a higher specific gravity than water, reflecting a higher concentration of solutes in the urine.

To know more about gravity click here:

https://brainly.com/question/31321801

#SPJ11

As you consider your answer, you might think about a spool of thread. If you pass a length of thread through the center hole, is the thread inside the spool?

Answers

Yes, the thread is inside the spool when it is passed through the center hole.

This is because the spool is a three-dimensional object with a hollow center, which is designed to hold the thread. Even if only a small portion of the thread passes through the center hole, it is still considered to be inside the spool because it is contained within the spool's structure.

From a technical standpoint, we could say that the thread is "partially" inside the spool. However, in everyday language, we would simply say that the thread is inside the spool. This is because the spool is primarily designed to hold the thread, and the fact that the thread is passing through the center hole is just a means of accessing it.

To learn more about spool, here

https://brainly.com/question/13094334

#SPJ1

Use the drop-down menus below to complete the following statement. the system contains glands that secrete hormones into the bloodstream, whereas the system secretes substances through ducts.

Answers

The endocrine system contains glands that secrete hormones into the bloodstream, whereas the exocrine system secretes substances through ducts.

The endocrine system is responsible for producing and secreting hormones directly into the bloodstream to regulate various bodily functions, such as growth and development, metabolism, and reproduction.

These hormones act as chemical messengers and travel throughout the body to target cells or organs that have specific receptors for that hormone. The glands of the endocrine system include the pituitary gland, thyroid gland, adrenal gland, and pancreas, among others.

On the other hand, the exocrine system includes glands that secrete their products through ducts or tubes into a particular organ or onto a surface, such as the skin or digestive tract.

These secretions may include enzymes, mucus, or sweat, and serve various functions, such as aiding in digestion or protecting the skin from dehydration or infection.

Examples of exocrine glands include the salivary glands, sweat glands, and mammary glands.

To know more about "Endocrine system" refer here:

https://brainly.com/question/3534540#

#SPJ11

Answer: here's your answer

Explanation

 ✔ endocrine

endocrine✔

✔ endocrineexocrine pituitary gland✔

endocrine thyroid gland

endocrine✔ exocrine salivary glands

Cellular respiration occurs in the muscle cells in a horse's thigh. Glucose is broken down producing carbon dioxide and water. What is the result of this cellular activity for the horse?​

Answers

The result of cellular respiration in the muscle cells of a horse's thigh is the production of ATP (adenosine triphosphate) that can be used for energy.

During cellular respiration, glucose (C₆H₁₂O₆) is oxidized and broken down into carbon dioxide (CO₂), water (H₂O), and energy in the form of ATP. In the presence of oxygen, this process is known as aerobic respiration, which is the primary means of producing ATP in eukaryotic cells.

The carbon dioxide produced in this process is carried to the lungs where it is exhaled, while the water produced can be used to help maintain the body's hydration.

The ATP produced is then used by the horse's muscle cells to carry out various functions such as movement, maintenance of body temperature, and other metabolic processes. Therefore, cellular respiration plays a vital role in providing the horse with the energy it needs to carry out its daily activities.

To know more about cellular respiration, refer here:

https://brainly.com/question/13721588#

#SPJ11

30 POINTS

1. What are some of the animals that have gone extinct? How have humans reacted to extinction?

2. What is ancient DNA?

3. How could scientists bring back an extinct species? How does this relate to genetics?

4. Why would it be important to sequence, as much as possible, the genome of extinct species?

5. Which research or conservation project discussed in the video did you find most interesting? Why?

Answers

Scientists could potentially bring back an extinct species by cloning it using its preserved genetic material.

What is the DNA?

They could also use genetic engineering techniques to modify the DNA of living organisms to resemble that of the extinct species. These techniques involve extracting and analyzing the ancient DNA to determine its genetic makeup and using that information to recreate the species' genome.

This relates to genetics because the genetic makeup of an organism determines its physical and behavioral characteristics, and by analyzing the DNA of an extinct species, scientists can understand its unique traits and potentially recreate them.

Why would it be important to sequence, as much as possible, the genome of extinct species?

Sequencing the genome of extinct species is important because it provides valuable information about the genetic makeup of these organisms, their evolution, and their relationships to living species. It can also help scientists understand the reasons for their extinction and potentially develop ways to prevent future extinctions.

Learn more about DNA from

https://brainly.com/question/2131506

#SPJ1

Organisms use different methods to obtain energy that they need to perform life functions. Which of the following can be an autotroph or a heterotroph?
A. bacteria and fungi
B. fungi and viruses
C. bacteria and protists
D. fungi and protists

Answers

The organisms that can be an autotroph or a heterotroph are bacteria and protists (option C).

What are autotroph and heterotrophs?

Autotroph is any organism that can synthesize its food from inorganic substances, using heat or light as a source of energy.

On the other hand, a heterotroph is an organism which requires an external supply of energy in the form of food as it cannot synthesize its own.

Protists are living organisms that belong to the kingdom Protista, which can either be autotrophic like green algae or heterotrophic like amoeba.

Also, certain bacteria like blue green algae are autotrophic while Pseudomonas is an example of heterotrophic bacterium

Learn more about autotroph at: https://brainly.com/question/11209881

#SPJ1

HELP!!!!!!!!!!!!!!! Please quick

Answers

Another organism in a marine ecosystem is a producer. Option C is correct.

In a marine ecosystem, the sun’s energy is trapped by producers to synthesize food through photosynthesis. The most abundant and widespread producer in a marine ecosystem is the phytoplankton. Apart from this seaweeds and seagrasses also form the producers in the marine ecosystem.

Consumers are heterotrophic and they depend on producers such as phytoplanktons for their energy needs. In a marine ecosystem, zooplanktons are herbivores. They are at the second level in the trophic level and they consume phytoplankton. Zooplankton are further consumed by carnivores like fish and jellyfish. After this comes the second-level and third-level carnivores which include large fish, squid, and octopus.

To learn more about a marine ecosystem, refer to the link:

https://brainly.com/question/1747534

#SPJ1

Give a reason why the total population in the world might be close to 50:50 males to females, but any one family, town, state, country might have a 50:50 ratio

Answers

The total population in the world may be close to a 50:50 ratio of males to females due to the biological nature of human reproduction.

The likelihood of conceiving a male or female child is determined by the sperm of the father, which carries either an X or a Y chromosome. Since there is an equal chance of conceiving a male or female child, over time, the natural balance of males to females is maintained.

However, any one family, town, state, or country may not have an exactly equal ratio of males to females due to various factors such as migration patterns, cultural practices, and social norms. For example, in some cultures, there may be a preference for male children, leading to a higher number of males being born. Conversely, in countries with higher rates of female education and employment, there may be more women than men. Additionally, migration patterns may result in a skewed gender ratio in certain areas.

Overall, while the biological likelihood of a 50:50 ratio of males to females is present, societal factors can lead to a different ratio in any given population.

To know more about total population click here:

https://brainly.com/question/4595675

#SPJ11

what theory states - organs that are similar in origin but not necessarily in function. (8 letter word)​

Answers

Answer:

hi

Explanation:

Homologous organs are organs that evolve from the same ancestor. They have the same organ structure but different organ functions. Eg, the Forelimbs of humans, whales, cats, and dogs. Homologous organs are a result of divergent evolution.

Other Questions
Which tool can help noah determine how much pollution control is practical and possible in a given situation? noah wants to determine how much pollution control is practical and possible in a given situation. he can make use of a(n) . Among 130 pupils, 30 liked both biscuits and chocolates, 10 liked neither and twice as many as liked biscuits liked chocolates.I) How pupils liked: chocolates, biscuits and exactly one of the two. What are the Actual dimensions of the house(in ft) bacteria in a culture is given by function n(t)=920e^0.35t Given cards with the letters A, B,C, and D, how many differentorders can you place the fourcards? Radikha married --------- Rajkumar Three vertices of parallelogram wxyz are w(-5,2), x(2,4), and z(-7, -3). find the coordinates of vertex y.the coordinates of vertex y are Based on the information in the picture and text write three questions about rationing and its relationship to life on the home front in American during world war 2 Convert the following circuit using NAND Question 11(Multiple Choice Worth 2 points) (Line of Fit MC) A scatter plot is shown on the coordinate plane. scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4 Which of the following graphs shows a line on the scatter plot that fits the data? scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing through the coordinates 1 comma 2 and 2 comma 3 scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing through the coordinates 1 comma 2 and 8 comma 4 scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing close through the coordinates at about 2 comma 3 and 8 comma 5 scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing through the coordinates 1 comma 3 and a half and 2 comma 3 and a half . let u = , v = . find u + v. (1 point)how to find find u+v? Approximately ____ percent of professionals working on virtual teams have never met their teammates in person, Mutiple Choice a 25 b 40 c 75 d 90 Lines AC and DB intersect at point W. Also, mDWC=138. PLEASE HELP TY What is the central idea of this poem?Women must be happy in order to enjoy protection.When protected, women experience total happiness.Religious customs, like the Pardah, lead tohappiness.No one, no matter how protected, can escape thesorrow in life. Compare Zora Neale Hurston's Sweat with Spunk For an experiment, Bea recorded how much each of 14 seedlings grew in one month. She made a line plot to show the data. Which value occurred most often? Anyone know how to solve this? Can anybody help me ASAP 98. How many start codons are there?99. How many stop codons are there?100.101. The process of translation takes place in the102. Replication and Transcription both take place in theSecond baseFirst baseUGUUUUUCUUAUUGCUUCUCCUACUGsignals the end of the process ofGUUGUCGUAGUGlek ne(LewAUUAUCAUAAUG theone (Met)(ke)ne(Val)UCUUCCUCAUCGCCUCCCCCACCGACUACC theACA(MhviACGGCUGCCGCAGCGAlaUAUUACUAAUAGAAUAACCAU histidineCACCAACAG6AAAAAGGAUGACtyfouneGAAGAGSTOPgutamineof the cell.(Avilboneof the cell.UGUUGCUGAUGG tryptophan (1)CGUCGCCGACGGAGUAGCAGAAGGpart and GGUGGOGGAGGGKVMargune(Arg)(Gly)DYSCU3Third baseGC when an investor compares their required return to the expected return on an investment, they are utilizing the explain in 100 words