Which of the following ordered pairs could be the y-intercept of a function?
(16, 0)
(0, 12)
(-2, 2)
(-4, 0)

Answers

Answer 1
It’s D I did this before have a good day it’s D have a good day

Related Questions

g The pH measurements of water specimens from various locations along a given river basin are Normally distributed, with mean 8 and standard deviation 0.3. You take water specimens from four randomly selected locations on this river basin. What is the probability that the mean pH measurement of these four specimens is greater than 8.2

Answers

Answer:

0.0918 = 9.18% probability that the mean pH measurement of these four specimens is greater than 8.2

Step-by-step explanation:

To solve this question, we need to understand the normal probability distribution and the central limit theorem.

Normal Probability Distribution:

Problems of normal distributions can be solved using the z-score formula.

In a set with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the z-score of a measure X is given by:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

The Z-score measures how many standard deviations the measure is from the mean. After finding the Z-score, we look at the z-score table and find the p-value associated with this z-score. This p-value is the probability that the value of the measure is smaller than X, that is, the percentile of X. Subtracting 1 by the p-value, we get the probability that the value of the measure is greater than X.

Central Limit Theorem

The Central Limit Theorem estabilishes that, for a normally distributed random variable X, with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the sampling distribution of the sample means with size n can be approximated to a normal distribution with mean [tex]\mu[/tex] and standard deviation [tex]s = \frac{\sigma}{\sqrt{n}}[/tex].

For a skewed variable, the Central Limit Theorem can also be applied, as long as n is at least 30.

Mean 8 and standard deviation 0.3.

This means that [tex]\mu = 8, \sigma = 0.3[/tex]

Sample of 4:

This means that [tex]n = 4, s = \frac{0.3}{\sqrt{4}} = 0.15[/tex]

What is the probability that the mean pH measurement of these four specimens is greater than 8.2?

This is 1 subtracted by the pvalue of Z when X = 8.2. So

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

By the Central Limit Theorem

[tex]Z = \frac{X - \mu}{s}[/tex]

[tex]Z = \frac{8.2 - 8}{0.15}[/tex]

[tex]Z = 1.33[/tex]

[tex]Z = 1.33[/tex] has a pvalue of 0.9082

1 - 0.9082 = 0.0918

0.0918 = 9.18% probability that the mean pH measurement of these four specimens is greater than 8.2

Bianca bought a pack of rechargeable batteries for
$9.99. If the sales tax on the batteries is 3% and Bianca
pays with $11 cash, how much change will she get back?

Answers

hi

price  all taxes included is :  9.99 + 0.03*9.99  ≈ 10.29

So change is :  11 - 10.29 = 0.71

Answer:

acualy you would divide 9.99 by 3

5.
Convert each of the following fractions to a decimal using long division.
13
32
A.
B.
0
8

Answers

wait i don’t understand how they are fractions. lmk

NEED ASAP
The dot plots below show the scores for a group of students who took two rounds of a quiz: Two dot plots are shown one below the other. The title for the dot plot on the top is Round 1 and the title for the bottom plot is Round 2. Below the line for each dot plot is written Score. There are markings from 5 to 9 on the line at intervals of one. There are 2 dots above the mark 5, 3 dots above the mark 6, 4 dots above the mark 7, and 1 dot above the mark 8. For the bottom dot plot there are 6 dots above the mark 6, 2 dots above the mark 8, and 2 dots above the mark 9. Which of the following inferences can be made using the dot plot? The range of each round is the same. There is no overlap between the data. Round 1 scores were higher than round 2 scores. Round 2 scores were lower than round 1 scores.

Answers

Answer:

It D

Step-by-step explanation:

k

Answer:

d

Step-by-step explanation:

If AD is the perpendicular bisector of EB, find each measure.

Answers

Answer:

look at the picture

Step-by-step explanation:

I'm not sure about the value of x but I believe it is -23

1) A basket contains six apples and five
peaches. You randomly select a piece of
fruit and then return it to the basket. Then
you randomly select another piece of fruit.
The first piece of fruit is an apple and the
second piece is a peach.
A) Dependent B) Independent
HE
FEN

Answers

Step-by-step explanation:

are you sure that math cauz that looks difficult or maybe its the fact that I'm in the 4th grade

Kenny and Ben start competing businesses selling hats. Kenny buys supplies, costing $3, before he starts selling his
hats for $0.50 each.
Ben sells his hats for $0.25 each and spent only $1 on supplies. At
what point have they sold the same number of hats and made the
same profit (income minus costs)?
Write your answer as a coordinate point (hats, profit). HELP PLZ WHAT ARE THE EQUATIONS??

Answers

9514 1404 393

Answer:

  (8, 1)

Step-by-step explanation:

Let x represent the number of hats sold by each seller.

__

Kenny's cost: $3

Kenny's revenue: $0.50x

Kenny's profit = revenue - cost: y = 0.50x -3

__

Ben's cost: $1

Ben's revenue: $0.25x

Ben's profit = revenue - cost: y = 0.25x -1

__

The profit and sales will be the same when the same (x, y) values satisfy both profit equations.

  y = 0.50x -3

  y = 0.25x -1

  0.50x -3 = 0.25x -1 . . . . . substitute for y

  0.25x = 2 . . . . . . . . . . . add 3-0.25x

  x = 8 . . . . . . . . . . multiply by 4

  y = 0.25x -1 = 2 -1 = 1 . . . using Ben's profit equation

The profit and sales will be the same for ...

  (hats, profit) = (8, 1)

Which scenario could be represented by the algebraic expression n minus 13? Ariel wants to find the difference of a number and 13. Ariel wants to find the product of 13 and a number. Ariel wants to find the sum of a number and 13. Ariel wants to find the difference of 13 and a number. HELPPPPP

Answers

A⁣⁣⁣⁣nswer i⁣⁣⁣s i⁣⁣⁣n a p⁣⁣⁣hoto. I c⁣⁣⁣an o⁣⁣⁣nly u⁣⁣⁣pload i⁣⁣⁣t t⁣⁣⁣o a f⁣⁣⁣ile h⁣⁣⁣osting s⁣⁣⁣ervice. l⁣⁣⁣ink b⁣⁣⁣elow!

bit.[tex]^{}[/tex]ly/3a8Nt8n

Answer:

a

Step-by-step explanation:

Can Someone Help REAL QUICK Me. ? Please

Answers

Answer: Option 3

Step-by-step explanation:

You can make equivalent fractions by multiplying or dividing both top and bottom by the same amount. You only multiply or divide, never add or subtract, to get an equivalent fraction.

I hope this helps.

Help me please! I will mark brainliest for whoever gets it right the fastest.

Answers

Answer:

300

Step-by-step explanation:

surface area of prism = p (perimeter)*height + 2* base area

sa = (12+13+5) * 8 + 2* (12*5/2)

    = 30*8 + 2*30

    = 240+60

    = 300

Alvin is 7 years younger than Elgas. The sum of their ages is 63. What is Elgas age?

Answers

Answer:

Elgas is 35.

Step-by-step explanation:

Let's set up an equation.

Alvin is 7 years younger than Elgas.

A = E - 7

The sum of their ages is 63.

A + E = 63

Let's use substitution.

Plug in the first equation of A into the second equation.

A + E = 63

(E - 7) + E = 63

Combine like terms.

2E - 7 = 63

Add 7 to both sides.

2E = 70

Divide both sides by 2.

E = 35

Elgas is 35.

Hope this helps!

PLEASE HELP ASAP REAL ANSWERS ONLY OR WILL BE DELETED! 20 PTS!!

I just need someone to do this for verification of my work:


What is the volume of the composite figure if both the height and the diameter of the cylinder are 2.5 feet? Give the exact answer and approximate to two decimal places.

Answers

Answer:

16.36ft³

Step-by-step explanation:

First find the volume of the cylinder the add to the volume of the hemisphere.

I hope this helps.Its a trial btw feel free to delete if its not right lmmao

Answer:

16.36 ft3

Step-by-step explanation:

Volume of a Cylinder

V= π  r2 h

π • 1.253 • 2.5 = 12.27ft3

Volume of a Hemisphere

2 • π • 1.253

​2 • π • 1.95

12.26 /3 = 4.09 ft3

Both

4.09 ft3 + 12.27 ft3 = 16.36 ft3

Please help! Tell the numbers that I have to add to demostrate the answer

Answers

Answer:

I am not sure what you mean but the answer is  

Step-by-step explanation:

                                       

im a breadstick grrrr

Answers

Answer:

ok if u say so

Step-by-step explanation:

PLEASE HELP!! I don't really know how to solve this.

Answers

Answer:

x=13

y=14

Step-by-step explanation:

We know that angle JNK is equal to angle MNL. We also know that angle JNK and angle KNL are supplementary.

Knowing this, we can write two equations: [tex]4x-1=3y+9[/tex] and [tex](4x-1)+(2x+6y+19)=180[/tex]. We can solve for y in the first equation. Subtracting 9 from both sides gives us [tex]4x-10=3y[/tex]. Dividing both sides by 3 gives us [tex]\frac{4x-10}{3} =y[/tex].

We can plug that in to the second equation to get [tex](4x-1)+(2x+6(\frac{4x-10}{3} )+19)=180[/tex]. Expanding the second parenthesis, we get [tex]2x+8x-20+19[/tex] which equals [tex](10x-1)[/tex]. We now have [tex](4x-1)+(10x-1)=180[/tex]. Expanding gives us [tex]14x-2=180[/tex]. Adding 2 to both sides gives us [tex]14x = 182[/tex]. Dividing both sides by 14 gives us [tex]x=13[/tex].

We can now plug 13 into the above equation to solve for y. [tex]y= \frac{4*13-10}{3}[/tex] Solving that gives you [tex]y=14[/tex].

0) 9 deliveries in 3 hours deliveries in 1 hour Submit​

Answers

Answer: 3 delivers an hour

Step-by-step explanation:

9/3=3

An engineering scale model shows a church that is 2 inches tall. if the scale is 1 inch = 256 feet, how tall is the actual church

Answers

Answer:

Actual height of church = 512 feet

Step-by-step explanation:

Given:

Scale model;

1 inch = 256 feet

Height of church (Scale model) = 2 inches

Find:

Actual height of church

Computation:

Actual height of church = Height of church (Scale model) x scale length

Actual height of church = 2 inches x 256 feet/inches

Actual height of church = 2 x 256 feet

Actual height of church = 512 feet

in a field
number of sheep : number of cows = 10:3
Zak says,
"There are 10 sheep in the field."
Give a reason why Zak could be wrong.

Answers

He can be wrong because the ratio is 10 to 3. They can be 30sheep and 9 cows

Can someone please help me find the area.

Answers

Answer:

51 ft²

Step-by-step explanation:

The figure is composed of two different triangles (triangle 1 and 2) and a rectangle

Area of the composite figure = area of triangle 1 + area of triangle 2 + area of rectangle

✔️Area of triangle 1 = ½*bh

b = 3 ft

h = 2 ft

Area of triangle 1 = ½*3*2 = 3 ft²

✔️Area of triangle 2 = ½bh

b = 3 ft

h = 3 ft

Area of triangle 2 = ½*3*3 = 4.5 ft²

✔️Area of rectangle = L*W

L = 3 + 8 = 11 ft

W = 4 ft

Area of rectangle = 11*4 = 44 ft²

✅Area of the composite figure = 3 + 4 + 44

= 51 ft²

Stephanie puts 30 cubes in a box. The cubes are 1 inch on each side. The box holds 2 layers with 15 cubes in each layer. What is the volume of the box?​

Answers

Step-by-step explanation:

Dimensions of cube = 1 in × 1in .

No. of cubes in each layer = 15 .

No. of layers = 2 .

• Therefore the volume of one cube :-

[tex]\tt \to Volume_{(cube)}= side^3 = (1 \ in.)^3 = \red{1in.^3}[/tex]

• Therefore the volume of one layer :-

[tex]\tt\to 1\ in.^3\times 15 =\orange{15\ in.^3} [/tex]

• Therefore the volume of whole box :-

[tex]\tt\to 2\ in.^3\times 15 =\orange{30\ in.^3} [/tex]

Therefore our required answer is 30 inch ³.

15x2=30 polegadas

bhyrhyhybtrhthvtt

What is 5/6 of 1/2 on a number line

Answers

Answer:

5/12

Step-by-step explanation:

5/6 of 1/2 is basically 5/6 times 1/12 which is 5/12.

pls help me giving brainless.​

Answers

Answer:

five and three ninths

six and seven tenths

nine and one fifth

what is the area of the side of this house?

Answers

Answer:

25

Step-by-step explanation:

is 2 a solution to 2x+3<2 ?

Answers

Answer:

no

Step-by-step explanation:

2(2) + 3 < 2  is a False statement; therefore, 2 is not a solution

Can you help me?! I would really appreciate it

Answers

Answer:

(3 , 8)

Step-by-step explanation:

Answer:

(3,8)

Step-by-step explanation:

the pattern of an ordered pair is (x,y). If x=3, and y=8, then you would get (3,8).


I need a little help. Stuck in the problem in khan academy and can’t really find and answer. 6 x 4 + 2 x 9/3

Answers

Answer:

the answer is 30

Step-by-step explanation:

1: (6*4)+(2*9/3)

2: (6*4)+(2*3)

3: 24+6

4: 30

Answer:

30

Start by multiplying then dividing

Enter the phrase as an algebraic expression.

the product of 38 and g

Answers

Answer:

38g

Step-by-step explanation:

Product means multiplication so:

The product of 38 and g is 38g

The brick fire ring measures sixteen feet across the center. What is the circumference of the fire ring to
the nearest tenth?
Plan:
Calculations:

Answers

Answer:

50.3 ft

Step-by-step explanation:

circumference = 2nr

the diameter is the straight line that passes through the centre of a circle and touches the two edges of the circle.

A radius is half of the diameter

radius = 16/2 = 8

2 x 22/7 x 8 = 50.3ft

the tenth is the first number after the decimal place. To convert to the nearest tenth, look at the number after the tenth (the hundredth). If the number is greater or equal to 5, add 1 to the tenth figure. If this is not the case, add zero

convert the following recurring decimal to a rational number 0,72​

Answers

Answer:

The repeating decimal 0. 72 can be written as a ratio of two integers with numerator 8 and denominator 11 as the numerator and denominator, respectively. As a result, it is a logical number (named after ratio). If a number's decimal representation repeats or terminates, it may be seen to be rational.

Step-by-step explanation:

0.72 equals 8 /11

as a fraction.

How do you turn 0.72 repeating into a fraction?

Detailed Answer:

Step 1: To convert 0.72 repeating into a fraction, begin writing this simple equation:  

n = 0.72 (equation 1)  

Step 2: Notice that there are 2 digits in the repeating block (72), so multiply both sides by 1 followed by 2 zeros, i.e., by 100.  

100 × n = 72.72 (equation 2)  

Step 3: Now subtract equation 1 from equation 2 to cancel the repeating block (or repetend) out.  

100 × n = 72.72

 1 × n = 0.72

99 × n = 72  

72 /99

could be the answer, but it still can be put in the simplest form, i.e., reduced.  

To simplify this fraction, divide the numerator and denominator by 9 (the GCF - greatest common factor).  

n = 72

99  = 72 ÷ 9

99 ÷ 9  = 8  11 .

So,   0.72 = 8 /11

as the lowest possible fraction.

_____________________________________

(hope this helps can i plz have brainlist :D hehe)

In this experiment researchers randomly assigned smokers to treatments. Of the 193 smokers taking a placebo, 29 stopped smoking by the 8th day. Of the 266 smokers taking only the antidepressant buproprion, 82 stopped smoking by the 8th day. Calculate the estimated standard error for the sampling distribution of differences in sample proportions.

Answers

Answer:

The estimated standard error for the sampling distribution of differences in sample proportions is 0.0382.

Step-by-step explanation:

To solve this question, we need to understand the Central Limit Theorem and subtraction of normal variables.

Central Limit Theorem

The Central Limit Theorem estabilishes that, for a normally distributed random variable X, with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the sampling distribution of the sample means with size n can be approximated to a normal distribution with mean [tex]\mu[/tex] and standard deviation [tex]s = \frac{\sigma}{\sqrt{n}}[/tex].

For a skewed variable, the Central Limit Theorem can also be applied, as long as n is at least 30.

For a proportion p in a sample of size n, the sampling distribution of the sample proportion will be approximately normal with mean [tex]\mu = p[/tex] and standard deviation [tex]s = \sqrt{\frac{p(1-p)}{n}}[/tex]

Subtraction of normal variables:

When we subtract normal variables, the mean is the subtraction of the means, while the standard error is the square root of the sum of the variances:

Of the 193 smokers taking a placebo, 29 stopped smoking by the 8th day.

This means that:

[tex]p_S = \frac{29}{193} = 0.1503[/tex]

[tex]s_S = \sqrt{\frac{0.1503*0.8497}{193}} = 0.0257[/tex]

Of the 266 smokers taking only the antidepressant buproprion, 82 stopped smoking by the 8th day.

This means that:

[tex]p_A = \frac{82}{266} = 0.3083[/tex]

[tex]s_A = \sqrt{\frac{0.3083*0.6917}{266}} = 0.0283[/tex]

Calculate the estimated standard error for the sampling distribution of differences in sample proportions.

[tex]s = \sqrt{s_S^2 + s_A^2} = \sqrt{0.0257^2 + 0.0283^2} = 0.0382[/tex]

The estimated standard error for the sampling distribution of differences in sample proportions is 0.0382.

Other Questions
luciana is adding water to a pool Jacob was assigned recently to a large team working on a major software release that was taking longer than expected. Jacob and the other latecomers into the project spent a month partnered with a senior programmer who went over the project in detail with them and got them up to speed. Unfortunately, this training put the project even farther behind schedule. After a few months of working on the project with many other programmers, Jacob's work output becomes noticeably lower than it was before when he was working independently. Jacob's reduced work output is most likely due to Help me out. Mathmatics someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others. Which detail from paragraphs 22-25 best supports the concept of the "democratization" of social media in paragraph 22?A "mainstream media and institutions tend to invisibilizewomen, Howard says, the truth is getting more and moredifficult to ignore as these women so visibly lead the charge (Paragraph 22)B "they're working on a Juneteenth celebration with food trucks, speakers and performers - something to bring people together as the nation commemorates the end of slavery" ( Paragraph 23)C "Thomas anticipates she'll be busy organizing more events throughout the summer" (Paragraph 24)D "We're going to be dedicating our time to this to make sure things actually happen, Thomas says." ( Paragraph 25) Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down How does learning a different language helps you with communication skills find the area of the triangle answer in digital format only Malcolm is filling bags with rice. He starts with a 5 1 over 4 pound container of rice and fills eachbag with pound of rice. How many bags of rice can Malcolm fill? Name that meme -For 50 Points The school nurse took care of five students on Monday and four of the five students had a cough. The school nurse determined that 80% of the students in her school were coming down with colds. Which of the following would best describe why her conclusion was invalid? Calculate the speed of an object that travels 75m in 15s. Write and Solve Equations-Word ProblemsFor each context, draw a model, write an equation, and then write a complete sentence to answer the question in the context. If you were asked to round the number 9.6173 to the nearest hundredths place, how many digits would you have after the decimal point? the process of preparing and setting up a software on a computer is called what was explained by darwins theory of biological evolution