Which of the following environmental problem is associated with the African Sahel

Answers

Answer 1
Lack of rain in the dry season of the year

Related Questions

What are the economic, social, and political characteristics that represent cultural divergence on the Korean

Peninsula?

Answers

Answer:

South Korea has a mixed economic system which includes a variety of private freedom, combined with centralized economic planning and government regulation. South Korea is a member of the Asia-Pacific Economic Cooperation (APEC) and the Asia-Pacific Trade Agreement (APTA).

Explanation:

Hope i am not wrong

What is the main reason so few African leaders are replaced in free elections?

Answers

Answer:

The main reason so few African leaders are replaced in free elections is because the vast majority of African nations have serious socio-political and economic problems, which generate enormous political instability and serious situations of social tension. Thus, for example, countries like Mali have 75% of their population living on less than 2 dollars a day, while others, like Nigeria, increase this percentage to 92%.

Thus, these situations of poverty, need for primary resources and lack of opportunities generate social conflicts that, translated into politics, are the starting point for revolutions, dictatorships and other anti-democratic manifestations.

what kind of products are used with wood?

Answers

We can use wood for Bath towels, Toothpaste, Nail polish, Makeup, Disinfecting wipes, Medications, Paints, LCD screens, and Ping-pong balls. I hope this helps and have a great day! (Also brainliest would be appreciated but you don’t have to) :)
Bath towels, paint, make up, medications and more a brainliest will help :)

Seaweed are marine algae that grow attached to the ocean floor. The waves in the ocean pull the algae in all directions. What features helped the algae survive in such an habit?
A. Shallow root system
B. short unbranched stalk
C. Flexible, ribbon like leaves
D. Waxy coating over the leaves

Answers

I feel like the answer would be C or D

Answer: C, 100% sure this is the answer!

Explanation:

The photo shows the San Andreas fault zone. This is a fault formed at a transform boundary.

What would you expect to find along this fault?

rift valleys
volcanoes
earthquakes
mountains

Answers

Answer:

C. Earthquakes

Explanation:

Just did the quiz. It is not mountains.

Answer:

C

Explanation:

Which of the following statements is true?

Stars generate their own heat and light by splitting helium atoms into hydrogen.
Stars which are closer to Earth usually appear brighter than stars which are far away.
Scientists at the North Pole will see the same constellations as scientists at the South Pole.
Stars are different from planets because they are the only celestial bodies made entirely of gas.

Answers

Answer:

Scientists at the North Pole will see the same constellations as scientists at the South Pole.

Answer:

It's the second one.

Explanation:

what is the connection between population density and the size of congressional districts?​

Answers

Answer:

Apportionment in the United States involves dividing the 435 voting seats every ten years (hope this helped)

The connection between population density and the size of congressional districts is  Districts having a greater population density are often smaller.

What is congressional districts?

Congressional districts are subdivisions of an organization functions territory that represent the people of a territory in the greater congressional body. They are also known as voting boundaries, district boundaries, wards, and electorates in various countries.

District borders are designed with the purpose of having roughly the same population size in each district. Many people dwell in a small space in locations with high population density. As a result, districts with a greater population density have a narrower range.

Learn more about congressional districts here:

https://brainly.com/question/24938079

#SPJ2

How did the Islamic religion spread throughout Africa? In your own words please

Answers

Answer:

Explanation:

The islamic religion basically spread through people traveling to Africa .Merchants, traders, scholars, and missionaries basically came peacefully to the Africans and whoever at the time ruled the Africans tolerated the religion or converted to it themselves because they liked it or felt that it was safe or believable.

The ______ is the only Australian river to flow year-round.

Answers

Answer:

A

Explanation:

Answer:

Murray river

Explanation:

Who is the Prime minister of Bhutan??​

Answers

Answer: Lotay Tshering

Which of the following statements about political maps are true? Check all that apply. O A. They never show any physical features of land. B. They may show how areas are broken into countries and states. O C. They are the most common type of map. D. They will show capital cities, major cities, and large lakes or rivers.​

Answers

Answer:

B, C and D

Explanation:

I left an example below

I agree with their answer. Give them brainliest

Explain the process of longshore drift.

Answers

Answer:

Waves that hit the beach at an angle carry sand and gravel up the beach face at an angle. When the water washes back the sediment. is carried straight back down the beach face. Individual particles are moved along the beach in a zig zag pattern. This is called longshore drift.

One astronomical units is equal to _____.

the distance from the Earth to the moon
the speed at which light travels
the distance between the Earth and the sun
six trillion miles

Answers

Answer:

The distance between the earth and the sun.

Explanation:

1 AU is 93 million miles and that is how far we are from the sun.

Answer:

One astronomical units is equal to the distance between the Earth and the sun.

Explanation:

A 30-foot ladder is leaning against a wall. The foot of the ladder is 20 feet
from the wall. How high up the wall does the ladder reach?

Answers

Answer: it reaches 50 feet :)

Explanation:

30+20=50

Answer:

22.36 ft.

Explanation:

Pythagorean theorem; it's just b=c2﹣a2=30 squared﹣20 squared=22.36068

in which heat zones does Bhutan lie? give reason​

Answers

Answer:

Bhutan has three climatic zones: sub tropical in the south, temperate in the middle and sub alpine to the north. The subtropical zone lies at an altitude of about 1,800 m (5,900 ft.), between the foothills along the Indo-Bhutan border and the mid-Montana ranges.26-May-2020

Explanation:

Southern Bhutan has hot and humid subtropical climate that is fairly unchanging throughout the year. Temperature can vary between 15-30 degree celcius.

Mark as brainliest

it's for science because theres no option (please help)​

Answers

Answer:

i like cheese.........

Which precipitation and vegetation descriptions best fit an Aw climate in the Köppen classification? Which precipitation and vegetation descriptions best fit an Aw climate in the Köppen classification? Well-defined winter dry season; savanna with drought-tolerant trees Every month has 6 cm of precipitation or more; lush tropical vegetation At least 10 times as much precipitation in a summer month as the driest winter month; vegetation short and thick Well-defined summer dry season; vegetation sparse Short dry season, precipitation of driest month has less than 6 cm but equal to or greater than 10-R/25; thick green vegetation

Answers

Answer:

Well-defined winter dry season and savanna with drought-tolerant trees

Explanation:

In the Köppen classification, Aw climate refers to Tropical savanna climate with dry-winter characteristics. In this climate, there is low rainfall in winter which make it very dry while on the other hand, more rainfall occurs in the summer season. The vegetation of such type of climate is drought resistance because there is less amount of water is received by the area in this type of climate so that's why we can say that Aw climate is Tropical savanna climate.

what does a lower number on the magnitude scale mean?

Answers

Richter's magnitude scale – is a measure of the strength of earthquakes, developed by Charles Francis Richter and presented in his landmark 1935 paper, where he called it the "magnitude scale".[2] This was later revised and renamed the local magnitude scale, denoted as ML or ML .

I hope this answers help u :>
So firstly a magnitude scale measures the size of an earthquake! So the lower number on the magnitude scale means that the earthquake is not that strong and the higher it goes the bigger and stronger it is. No, earthquakes of magnitude 10 or larger cannot happen. No fault long enough to generate a magnitude 10 earthquake is known to exist, and if it did, it would extend around most of the planet!

I hope this helps if you have any question just message me and I hope can I help :)

assess whether the development of the internet and social media has caused a change in the way we communicate​

Answers

Answer:

Explanation:The digital society in which we all live has drastically altered reality across industries.  It’s changed the way we live , the way we work and, most importantly, the way we communicate.  

A by-product of this digital era, social networks have easily become one of the most dominant methods of communication.  

As one of the most popular methods for sharing thoughts and ideas, it’s important to examine how social media changed the way we communicate over time.  

Even further, brands attempting to use social media to reach potential customers need to make sure they’re adapting their communication styles accordingly.

The digital culture in which we all live has profoundly impacted reality in many fields. The way we work, live, and, most crucially, communicate have all altered as a result.

How has the Internet changed the way we communicate in society today?

Social media, emails, and text messaging help make communication now immediate. In a matter of seconds, we can send a message and get a response. We can rapidly exchange pictures, movies, and tales thanks to digital communication. Technology has altered how organizations promote, run, and engage with their workforce. Technology has increased business cooperation, cost control and employee communication.

Teams may now connect virtually using various tools, including email, instant messaging, direct messaging, and group collaboration software. Teleworking and video conferencing have also recently gained popularity as more individuals worldwide worked from home due to the coronavirus outbreak. Digital media has assimilated into daily life.

Learn more about the Internet in society here:

https://brainly.com/question/14297520

#SPJ6

What is the cause of changes in the direction of light?

Answers

Answer:

Light refracts whenever it travels at an angle into a substance with a different refractive index (optical density). This change of direction is caused by a change in speed. ... When light travels from air into water, it slows down, causing it to change direction slightly. This change of direction is called refraction

Light refracts whenever it travels at an angle into a substance with a different refractive index (optical density). This change of direction is caused by a change in speed. ... When light travels from air into water, it slows down, causing it to change direction slightly. This change of direction is called refraction.

Objetibo. conocerla morfologia externa a interna de los riñones . o distingir la distintas partes del riñon cual es

Answers

Answer:

Corteza renal, médula renal y pelvis renal.

Explicación:

Hay tres regiones principales del riñón, es decir, corteza renal, médula renal y pelvis renal. La corteza renal es la parte externa del riñón que se compone de glomérulos y túbulos contorneados. La corteza renal es responsable de la protección de las estructuras internas del riñón. La médula renal es la parte más interna del riñón que se divide en pirámides renales. La médula renal es responsable de la regulación de la concentración de orina. La pelvis renal es la región donde se unen los dos o tres cálices principales. La pelvis renal actúa como un embudo para la orina que fluye hacia el uréter.

Barns in rainier climates will need to have steeper slopes than barns in mild climates.


False

True

Answers

Answer:

True ..........

what are the dolls in russia called

Answers

Answer:

Matryoshka doll

Explanation:

Someone please help I really need help! (NO LYING ) (NO LINKS) sorry for annoying you.

6. This translation is an example of a(n)
because it preserves distance and angle measures.

Answers

Answer:

Sliding the diagram

Explanation:


Describe how the structure of a country’s population changes between stages 2 and 4 of the Demographic Transition Model

Answers

In stage 1 the two rates are balanced. In stage 2 they diverge , as the death rate falls relative to the birth rate. In stage 3 they converge again, as the birth rate falls relative to the death rate. Finally in stage 4 the death and birth rates are balanced again but at a much lower level.

The structure of a country's population shifts from high birth and death rates in Stage 2 to low birth and death rates in Stage 4 of the Demographic Transition Model.

The Demographic Transition Model is a conceptual framework that describes the historical and projected population patterns of countries as they transition from high birth and death rates to low birth and death rates.

It illustrates the stages of demographic change based on the interplay between birth rates, death rates, and population growth over time.

The model typically consists of four or five stages, each representing a different demographic scenario.

These stages reflect changes in societal and economic factors, including improvements in healthcare, education, and economic development, which influence birth and death rates, ultimately leading to shifts in population size and structure.

Learn more about Demographic Transition Model here:

https://brainly.com/question/13146758

#SPJ4

ok guys this is the last one thank you guys sooooooooo much i love you all please go follow hawsbrooklyn bc she is a very very very very very very very veryvery very very veryvery very very veryvery very very veryvery very very veryvery very very veryvery very very veryvery very very veryvery very very veryvery very very very great and nice person bye i love you all i rlly hope she sees this

Answers

Answer:

<3

Thank you

Explanation:

u3hrkdjddnsk

Answer:

ok i will

Explanation:

i hope you dont reget this ...bye

Isumi and San Luis Obispo are the same distance from the equator, and they are both near the ocean. Using the information in the map, how does the air temperature of Isumi compare to the air temperature of San Luis Obispo? Why? The air temperature at Isumi is

Answers

Answer:

a

Explanation:

Which organelle contains DNA?
A. Golgi
C. Rough ER
B. Nucleus
D. Smooth ER

Answers

nucleus

Known as the cell's “command center,” the nucleus is a large organelle that stores the cell's DNA (deoxyribonucleic acid).

Answer:

B. Nucleus

Explanation:

Constellations _____.

look the same all over the Earth
are always found in the same place
are groups of stars which are close together in space
would not look the same to astronauts on the moon

Answers

Answer:

look the same all over the Earth

Explanation:

Answer:

It's actually D. would not look the same to astronauts on the moon

How are balances of power reflected in political boundaries and government power structures ?

Answers

Answer:

balances of power define the structure of a government and the size of its boundaries.

Explanation:

Balances of power define the structure of a government and the size of its boundaries. Thus, balances of power reflected in political boundaries and government power structures.

What is a balance of power?

It is the idea that states consciously or unconsciously strive for an equal distribution of power in order to avoid dominance by one. The balance of power is the system by which the government's public entities, and even nations among themselves, control their power so that no one obtains excessive prerogatives over the others.

The various bodies establish political limits for the exercise of power, such as the system of checks and balances, which requires Congress, for example, to authorize certain acts of the President in order for them to be fully valid.

Therefore, balances of power are reflected in political boundaries and government power structures.

To learn more about balance of power, click here:

https://brainly.com/question/18828705

#SPJ2

Other Questions
Diego bought some raisins and walnuts to make trailmix. Raisins cost $4 a pound and walnuts cost $8 apound. Diego spent $15 on both ingredients. Decide ifeach pair of values could be a combination of raisinsand walnuts that Diego bought.Explain your answer. HELPP!!!!!!!!!!!!!!!! What transformation is shown below?reflectioncan't be determinedrotationtranslation In triangle ABC, angle A measures 50.5 degrees and angle B measures 74 degrees. What is the measure of angle C? DO NOT TRY TO PUT A DEGREE SIGN. JUST TYPE THE ANSWER!! - 1:Translate the following sequence into a short protein. Add hyphens between,please.235'- AUG GCA AAA GAG GAA CAU UAA - 3'56Second LetterUAGPheTyrSerUUUUUUCUUAUUGUCUUCCUCAUCGUAUUACUAAUAG39LeuStopStopUGUCys UUGCUGA Stop AUGG Trp GCGUCGCArgCGAGHisProCUUC | CCCUACUGCCULeu CCCCCACCGCAUCACCAACAGGin121st3rdCGGletterAsnSerlleAUUA AUCAUAAUGACUACCACAThrAAUAACAAAAAGAGUAGCAGAAGGU letterAG15Lys|ArgMet ACGAspGUUGGUCGUAGUGValAlaGCUGCCGCAGCGGAUGACGAAGAGGGUGGCGGAGGGGly|Duco18Gluhttp://biology.kenyon.edu/courses/biol114/Chap05/Chapter05.html1 Kailynn has been on a roll, and solving 5 math problems every 2.5 minutes. At this rae, how many problem will she solve in 30 minutes. What is the slope of the line in the graph? please help me with this please, this is due in a couple of minutes. Which states the best reason why Chapter 15 might be titled "Nest-Building"?The robin is building a nest in the garden.A nest is a symbol for a safe place where Mary and Colin can grow.The robins are a symbol for new life returning to the garden.Mary and Dickon want Colin to watch the robin building the nest. You estimate that there are 40 marbles in a jar. The actual amount is48 marbles. Find the percent error. Round to the nearest tenth of a percent. help me plz which formula should I use?? What is the pear harbor and what happened 1. When did Texas become a territory of the United States? 5 oranges are bought for $4.00 and later sold at $0.10 each .find the loss percent. What is an advantage to being ectothermic?Question 18 options:Ectothermic animals require much less energy to survive than endothermic animals. Ectothermic animals can sleep longer than endothermic animals. Ectothermic animals always live longer than endothermic animals. Ectothermic animals can live in a greater number of environments than endothermic animals. Why is it important for the brain to be so well protected? Bryson is painting kitchen stools. Each stool requires 1 1/2 liters of paint. Bryson has 20 liters of paint, How many stool will he be able to paint? En France, on sert toujours une salade verte au dbut d'un repas.TrueFalseNEXT QUESTIONASV COR irin How are ionic compounds named? What is the volume of the square pyramid ?