Which of the following defines Statutory Law? *
1 point
laws created by government agencies
laws that come from judges' decisions that rely on common sense and previous
cases
laws passed by Congress and state and local governments
laws based on the constitution

Answers

Answer 1
Answer: Laws passed by Congress and State and local governments

Hope this helps!

Related Questions

Can you read this??


Dndkfrjjdfjjd

Answers

Answer:

I can't read the picture because it's too pixelated, but "Dndkfrjjdfjjd"

clearly means "Da National Day Known For ReJoicing Joe's Dad For Joyous Jiving Dogs".

Describe the net movement of water when a dialysis bag containing a 0.2 M sucrose solution is placed into distilled water, which contains no solutes.

a. There will be no movement of water.
b. Water will move into the bag.
c. Water will move into the beaker.
d. There will be no net movement of water.

Answers

Answer:

b

Explanation:

The correct answer would be that water will move into the bag.

The 0.2 M sucrose solution in the dialysis bad has a lesser water potential when compared to the distilled water that has no solutes. By law, water moves from the region of higher water potential to the region of lower water potential. The dialysis bag will, hence, act as a semi-permeable membrane and allow water into the bad from the surrounding distilled water.

The correct option is b.

Scientists are working with a liquid that is made of only one type of atom. Which statement correctly describes this liquid?

Answers

The liquid contains only one element, therefore - the liquid is a pure substance

Answer:

b

Explanation:

edge 2021

What two systems are affected by the common cold and why

Answers

Answer: nose, throat, and sinuses

Explanation:

because its an infection of the upper respiratory system.

Genes A and B are neutral. A weakly beneficial mutation arises in the population. This mutation is 100 base pairs away from Gene A and 1000 base pairs away from Gene B. If this mutation were to go to fixation within the population, which gene would be more likely to go to fixation and what is the term for this process? Is there any reason to suspect that one or both of these genes may not go to fixation? Why or why not?

Answers

Answer:

Both genes would be likely to go to fixationThe term for this process is "linked genes"The reason to suspect that both of these genes may not go to fixation is that they are too close to the mutation and the recombination frequency between them is very very low.

Explanation:

Independent assortment law establishes that the alleles from two or more different genes distribute in gametes independently from each other. In other words, a gamete receives an allele from a gene that does not depend nor influence the allele of another gene in the same gamete. This can only be applied to independent genes. These genes segregate independently after crossing-over because they are located far away from each other.

Some other genes, however, are too close to each other and they do not segregate independently. These are the linked genes that do not exhibit an independent distribution, and they inherit together more frequently.  

Crossing-over between linked genes that are very close to each other in the chromosome is not that common. Crossing-over during meiosis occurs randomly in different positions all along the chromosome, and its occurrence frequency in the area between two genes depends on the distance between them. A short distance between genes is a very little target for crossing-over to occur, which means that only a few of them will happen, compared with the number of events between genes that are more separated between each other.  

Two genes that are very close will have a few recombination events and are strongly bounded.  

The more separated two genes are, the more chances of recombination there will be.  The closer they are, the fewer chances of recombination there will be.

Genes that express 50% of recombination frequency or more are not linked genes.  

To analyze the recombination frequency, we have to know that

1% of recombination = 1 map unit = 1centi Morgan = 1,000,000 base pairs.

And that the maximum recombination frequency is always 50%.  

The map unit is the distance between the pair of genes for which every 100 meiotic products one of them results in a recombinant one.  

In the exposed example we know that the distance of gene A from the mutation is 100 base pairs, and the distance of gene B from the mutation is 1000 base pairs.

1,000,000 base pairs ------------------ 1% recombination frequency

1000 base pairs -----------------------X = 0.001% recombination frequency

100 base pairs ------------------------ X = 0.0001% recombination frequency

According to the recombination frequency between the mutation and gene A, and between the mutation and gene B, we can assume that both genes are linked to the mutation, as they seem to be too close to it. They are so close, that their recombination frequency is very little.  

                                             

How do scientists say the melting ice can contribute to disease occurrence? Also example

Answers

Answer:

In the melting of icebergs, icebergs could potentially contain long-dormant bacteria and viruses. Those viruses trapped in ice and permafrost for centuries, can be reactivated. That means melting those ice could potentially open a Pandora's box of diseases.  Including some that have caused global epidemics in the distant past.

Example: babesiosis

As of regular ice. The freezing of bacteria in water isn't just an old practice and ice from unclean sources could also contain disease, when melted and ingested or touched this ice as well could transmit disease not so long-dormant, however still unpleasant.

Example: AIDS

Why does the Ocean appear to be blue?

A, because all light that reach the the ocean's surface is blue light

B, As light travels through the ocean, red and orange light gets absorbed first while blue light
continues to travel deeper, make the ocean appear to be blue

C, As light travels through the ocean, blue light gets absorbed first, which makes the ocean appear to be blue

D, The surface of the seafloor is blue

Help please

Answers

I do believe the answer is B

Answer:

its because the sky is blue and it reflects to the ocean

Which compares the problems associated with radioactive waste created from generating electricity using fusion reactions to waste created from generating electricity using fission reactions?

A. The radioactive waste from fusion reactions becomes less hazardous much sooner than the waste from fission reactions.

B. The radioactive waste from fission reactions becomes less hazardous much sooner than the waste from fusion reactions.

C. Although their radioactive wastes are hazardous for the same period of time, fusion reactions produce less waste than fission reactions.

D. Although their radioactive wastes are hazardous for the same period of time, fission reactions produce less waste than fusion reactions.

Answers

Your answer is to your question is A

Radioactive waste from fusion reactions becomes less hazardous much sooner than waste from fission reactions, nuclear fusion is much safer than fission because it leaves no radioactive waste behind.

What is the difference between the two reactions?

Both processes are natural, but they can also be done in a laboratory. While fusion occurs when two atoms are "crushed" to form a single atom of a new element, fission consists of the splitting of an atomic nucleus.

With this information, we can conclude that Radioactive waste from fusion reactions becomes less hazardous much sooner than waste from fission reactions, nuclear fusion is much safer than fission because it leaves no radioactive waste behind.

Learn more about nuclear fusion in brainly.com/question/12701636

#SPJ2

What is the complementary strand for the following DNA segment?
C A A G T T C G A T G A

Answers

Answer:

GTTCAAGCTACT

Explanation:

studied

Why does the amount of energy available change as you move from one
trophic level to the next? Does this process still follow the Law of
Conservation of Energy? Explain your reasoning.

Answers

Answer:

hope it helps you

Explanation:

Energy decreases as it moves up trophic levels because energy is lost as metabolic heat when the organisms from one trophic level are consumed by organisms from the next level. Trophic level transfer efficiency (TLTE) measures the amount of energy that is transferred between trophic levels.

When you are sitting in a bath, are your skin cells in a hypertonic or hypotonic solution?

Answers

Answer:

hypotonic

Explanation:

PLEASE HELP!!!!!!!!!!!!!!!!!!!!

Which statement describes competition within a population?

Several killer whales migrate to a new location.
Two male sea horses fight to win over a female.
Several elk travel together to find and share water.
Different kinds of garden plants take in water from the soil.

Answers

Answer:

I think its B if I'm wrong I'm sorry

Two male sea horses fight to win over a female describes the competition within a population. So, the correct option is B.

What is Competition?

Competition is defined as an interaction between organisms or species in which both require a resource in limited supply that reduces the fitness of both organisms because the presence of one of the organisms always consumes the available resource which reduces the quantity.

Competition is defined as the fight between different organisms by limited resources. Some examples of interspecific competition between lions and leopards that vie for the same prey and interspecific competition between rice fields with weeds growing in the field, two male seahorses fighting to win over a female.

Thus, the correct option is B.

Learn more about Competition, here:

https://brainly.com/question/23571652

#SPJ3

do all prostars become stars why or why not

Answers

Answer:

no everyone can get popular but they can reach it if they try hard enough

Explanation:

Answer:

Not all of them because the crown might not like the much so that why they don't become famous

Explanation:

Which are characteristics of eukaryotic organisms? PLZ HELPP

Answers

Answer:

Eukaryotic cells are larger than prokaryotic cells and have a “true” nucleus, membrane-bound organelles, and rod-shaped chromosomes. The nucleus houses the cell's DNA and directs the synthesis of proteins and ribosomes.

Explanation:

Which molecule in Diagram 11 is used to transport energy to other parts of the plant?

Answers

Answer:

The answer is Sugars, or sugar molecules!

Explanation:

The sugar and other organic molecules are transported through the plant by means of a special layer of tissue called phloem. Phloem is composed of living cells that transport a water solution of sugars that we commonly call sap.

The  molecule is Sugar ,transported principally as Sucrose, but originally as Glucose after photosynthesis  and stored as starch in plants.

The sucrose is transported in the Phloem( one of the vascular tissues, the second is the xylem. They are located adjacent o each other.)The process of transportation is called, Pressure Flow Model. The process of moving the sugar through the plants is called Translocation.

There are two regions during transport of sugar in translocation. The source where the sugar is produced, that is the  green leaves, and the sink where the sugar is metabolized.

Therefore the high concentration of the sugar at the source([plant leaves) increases the solute potential of the cell in the phloem of the leaves. This set up a gradients that draw water from the adjacent  xylem into the phloem by osmosis.

The  water influx increases the pressure potential of the phloem sap, and which makes the phloem turgid. The creates turgor pressure because of the increases of the phloem sap (containing sugar).The pressure  leads to the bulk transport of the sap contain sugar (translocation) from the source( leaves) to the Sink.

At the sink, the sugar is withdraw . Thus the solute potential rises,(with a drop in pressure potential) and  water  return by osmosis back to the xylem for the process to continue with another transport.

More https://brainly.com/question/18518187

*WILL MARK BRAINLIEST!!* and you don't have to answer all of them! :D

A.) The middle lamella _____.
1.)surrounds and protects the chloroplast
2.)stores water inside the plant cell
3.)attaches plant cells to one another
4.)captures sunlight for use in photosynthesis

B.)Organisms cannot make their own food without _____.
1.)cell membranes
2.)cell walls
3.)chloroplasts
4.)vacuoles

C.) Chloroplasts _____.

1.)provide structure and support for plant cells
2.)are also found in animal cells, but they are much smaller
3.)are found inside the mitochondria
4.)allows plants, algae, and certain bacteria to make their own food

D.) Vacuoles are important for _____.

1.) energy production
2.) protection
3.) storage
4.) photosynthesis

E.) Which of the following statements is true?

1.) The rigidity of a cell wall causes plants to be sedentary.
2.) Primary cell walls are more rigid than secondary cell walls.
3.) Since they have cell walls, plant cells do not have cell membranes.
4.) A wilting plant will have a full central vacuole.

F.) Choose all the answers that apply.
Which of the following are only found in plant cells?
1.) cell membranes
2.) chloroplasts
3.) cell walls
4.) vacuoles

Answers

F) chloroplast and cell wall

Answer:

A: 3.)attaches plant cells to one another

B: 3.)chloroplasts

C: 4.)allows plants, algae, and certain bacteria to make their own food

D: 3.) storage

E: 1.) The rigidity of a cell wall causes plants to be sedentary.

F: 2.) chloroplasts  and 3.) cell walls

Explanation:

I got a 100 on this assignment i know all of these answers are correct

How does the respiratory system help maintain in the body?​

Answers

Answer:

The respiratory system works with the circulatory system to provide this oxygen and to remove the waste products of metabolism. It also helps to regulate pH of the blood. Respiration is the sequence of events that results in the exchange of oxygen and carbon dioxide between the atmosphere and the body cells.

it helps maintain ph in the blood and with gas exchange (oxygen in, carbon dioxide out)

ay whether each of the following situations is an example of altruism or reciprocity. a. Giving a few canned goods to the local food bank for its annual food drive: (Click to select) . b. Helping someone move her couch after she helped you study for an upcoming exam: (Click to select) . c. The biological relationship between cleaner fish and large predators in the ocean, in which cleaner fish keep the predator

Answers

Answer:

Altruism

Giving a few canned goods to the local food bank for its annual food drive

Reciprocity

Helping someone move her couch after she helped you study for an upcoming examThe biological relationship between cleaner fish and large predators in the ocean, in which cleaner fish keep the predator

Explanation:

Altruism is a biological concept used to describe the action of an organism which reduces its own fitness but increases the fitness of another organism. Reciprocity, on the other hand, refers to cooperation between two unrelated organisms in which the beneficial actions of one to the other is reciprocated either in the short or medium term.

Giving a few canned goods to the local food bank for its annual food drive is an action done to benefit those that patronize the food bank without any hope of it being reciprocated. Hence, it is considered altruism.

Helping someone move her couch after she helped you study for an upcoming exam and the biological relationship between cleaner fish and large predators in the ocean, in which cleaner fish keep the predator are both considered reciprocity.

suggest what sort of molecules insulin receptors are and state where they would be found

Answers

The answer is water because

The most common danger related to the destruction of CD4 T cells is

Answers

Answer:

AIDS

Explanation:

AIDS is the most common infectious disease causing lymphocytopenia, which arises from destruction of CD4+ T cells infected with HIV.

Scientists use english units of measurement true or false

Answers

Answer:

Falus

Explanation:

ANSWER: True

explanation: scientist use metric units

What type of radiation constitutes the basis for setting an SPF rating?

p

Answers

Answer:UV radiation

Explanation:

Select the terms that fit in the science category "Earth and Space." Select all that apply. water air animals land plants solar system light sound

Answers

Answer:

water

air

animals

plants

solar system

light

Explanation:

Earth is one of the nine planets and it is the one known to host human life. Earth is made up of the atmosphere which contains gases needed to sustain life. Water, air, animals, and plants can be found on the earth.

Space is a vacuum that hosts the galaxies and sun which make up the solar system. The Sun emits light which can be reflected on the earth as the planets revolve around the sun.  

To change behavior or actions in response to outside conditions 4 Letters. What is the word?

Answers

Answer:

The four-letter word which speaks to the ability of an organism to modify its behavior or actions to external stimuli is Move.

Explanation:

Movement gives organisms the ability to move away from or towards an external stimulus depending on whether it is a detrimental stimulus or a favourable one.

Examples of stimuli are:

Light: All organisms respond to the presence of light. Some stay away from it and remain at sleep until the sun goes down. They are called nocturnal. Others gravitate towards it. Plants always grow towards light.Temperature: Some organisms favour cold environments, other the temperate parts of the earthSound: The sound of a carnivorous animal such as the lion will put a deer to flight. The sound of a mother hen calling out to her chicks will attract them to her.

Cheers

If you ate more food from secondary consumers, how would this change the percentage of the biomass pyramid necessary to support your survival?

Answers

Answer:

would increase

Explanation:

The pyramid of biomass is a diagram that exhibits the total biomass of the organisms at different trophic levels, which are required to support life in a given ecosystem. This pyramid usually starts with producers situated on the bottom (e.g., plants), then continues with the organisms that eat these primary consumers (herbivores), after with secondary consumers (carnivores), and so successively. The pyramid of biomass indicates the amount of mass of 1-primary producers required to support the life of the primary consumers, 2- primary consumers needed to support the life of the secondary consumers, 3-secondary consumers needed to support the life of the tertiary consumers, and so successively for each trophic level. In this diagram, the trophic level with a higher amount of biomass (and energy) is usually represented by the producers (i.e., by organisms on the bottom), and this amount of biomass decreases as long as more levels are considered. In consequence, if more food from secondary consumers is consumed, it will produce an increase in the percentage of biomass that is needed to support life.

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Answers

GTTCAAGCTACTGTTCAAGCTACT

Please help now. I only have 3 minutes

Answers

Answer:

B

Explanation:



2. Which of the following does NOT contribute to globalization?
a) Countries protect their trade positions by increasing tariffs on foreign imports
b) Technological advances allow for decreased communications costs
c) Containerization makes international shipping inexpensive
d) Countries ratify new free trade agreements​

Answers

C) containerization makes international shipping expensive

Ozone blocks ____ radiation but greenhouse gasses trap _____ radiation.

Answers

Answer:

Ozone blocks ultraviolet radiation but greenhouse gasses trap infrared radiation.

Sugar made in the process of photosynthesis to sent to the mitochondria to produce _____.

Answers

Answer:

energy

Explanation:

i just know it. i like science

Sugar produced in the process of photosynthesis to sent to the mitochondria, is used to produce energy in the form of ATP through the process of cellular respiration.

What is Cellular respiration?

Energy is produced in the body through the food we eat. The food is broken down into simpler substances which are absorbed by the cells and in the cells are used to produce energy.

Sugar is produced by the process of photosynthesis in plants which is sent to the mitochondria to produce energy in the form of ATP (adenosine triphosphate). The process of oxidation of food to produce ATP is called cellular respiration.

The process of cellular respiration consists of three processes which include glycolysis (breakdown of glucose into pyruvate), citric acid cycle, and the oxidative phosphorylation which produces about 34-36 molecules of ATP in the mitochondria of cell.

Learn more about Energy here:

https://brainly.com/question/22342942


#SPJ2

Other Questions
box a and box b have the same density. box a had more volume. which box has more mass? What helped the growth of newspapers? Help asap im on a test :(People liked the news.There were more wars.People started to read.People like the photos. Can someone help me? Please Thank you. Can somebody plz write the list word that has the same meaning correct!! (Only if u for sure know it) WILL MARK BRAINLIEST!1) flower2) medicine3) hardworking4) strong5) characteristic how do I solve 2c-5=c+4 I don't get these kind of questions. Why is the golden rule important Jasper is using the following data samples to make a claim about the house values in his neighborhood:House ValueA $150,000B $175,000C $200,000D $167,000E $2,500,000Based on the data, should Jasper use the mean or the median to make an inference about the house values in his neighborhood? (10 points)Group of answer choicesHe should use the mean because it is in the center of the data.He should use the median because it is in the center of the data.He should use the median because there is an outlier that affects the mean. Woke out the following giving your answers in their simplest form 3/113/11 Please help me to solve this! Between which two whole number square root 44 must show work Consider the following cost function. A. Find the average cost and marginal cost functions. B. Determine the average and marginal cost when x = a. C. Interpret the values obtained in part (b). C(x) = 1000 + 0.1x, 0 x 50000 x 5000, a = 2000 Please help me . I attached a picture down below . I need a answer as soon as possible Jeff places a pineapple with mass of 890g on a balance scale. He balances the scale by placing 2 oranges, an apple and lemon on other side. Each orange weighs 280g. The lemon weighs 195g less than each orange. What is the mass of the apple? What components of an atom has no charge 8Li8 Be0eWhat type of radioactive decay is this? please help meeeee :( What is the relationship between the 5s in 345,502 can someone help me?What are your strengths in public speaking? What areas would you like to improve? Do you have any fears or anxieties when it comes to presenting in front of an audience? In 100 words or less, put yourself in the role of presenting and think about how you will handle the situation. Trace the path of rays in the following ray diagrams:Bent when it is partially dipped in watert HELP ASAPPPPP mL ABC=117 -> Find mL CBD