how does pollution travel from a river to the ocean?
a) pollution flows upstream toward the ocean
b) pollution flows downstream toward the ocean
c) pollution flows toward the bank of a river and then to the ocean
d) pollution flows toward the source of a river
Answer:
d
Explanation:
In rabbits, the gene for black fur is dominant over the gene for white fur. How can the appearance of white baby rabbits be explained when the mother has white fur, and the father has black fur?
Answer:
it is going to xx or xy those genes of the father and the father
What happens to the distance between waves Wave lengths 
Which of these is NOT true about vaccines?
a. they simulate a specific immune response
b. they cause memory cells to be produced
c. they contain an antigen of a weakened pathogen
d. it has been proven that there are many possible negative side-effects to being vaccinated
Answer:
I'm going to say A
Explanation:
because it just make more sense
Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)
Describe one method to reduce the air pollutants released from a coal burning power plant
Answer:
A method to reduce the air pollutants released from a coal burning power plant is carbon capture.
Explanation:
Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.
I mark Branliest for the correct answer quickly please listen to me Eyes Blue
Answer:
1(i think)
Explanation:
The nucleus controls and regulates the activities of the cell (e.g., growth and metabolism) and carries the genes, structures that contain the hereditary information. Nucleoli are small bodies often seen within the nucleus. The gel-like matrix in which the nuclear components are suspended is the nucleoplasm.
Water in the blood helps carry nutrients and gases required foe survival througout the body. Which characteristics of water allow for this action?
A.water has a neutral pH
B.water maintains temperature
C.what expands when it freezes
D.water dissolves many compounds
Answer:
Water has a neutral pH
Explanation:
None of the others exactly fit in with what this is saying, and water having a neutral pH allows the supplies and nutrients that it carries to stay safe within it throughout the way.
Sorry if this isn't correct or full-fledged explained like I normally do, I saw you said to hurry up and I didn't do my normal research and whatnot.
Anyways, hope this helped!
Sources: N/A
The characteristic of water that allows this process of carrying nutrients and gases is water has a neutral pH. Thus, the correct option for this question is A.
What are the characteristics of water?The characteristics of water are as follows:
It is a universal solvent. Due to the partial positive charge on hydrogen and partial negative charge on oxygen, it is a polar molecule. It has high heat capacity and high heat of vaporization. It has properties like cohesion and adhesion. Its solid form is less dense as compared to liquid.Due to having the property of neutral pH, water significantly performs movement across the entire body with the help of blood.
It does not form any barrier with the differences in the level of pH. So, along with blood, water carries nutrients and gases that must be required for proper survival throughout the body.
Therefore, water that has a neutral pH is the characteristic property that allows the carrying of nutrients and gases required for survival throughout the body.
To learn more about The properties of water, refer to the link:
https://brainly.com/question/18681949
#SPJ6
Babies with very low or very high birth weight are less likely to survive. The graph shows the percentage of babies born at different weights.
A graph entitled Percentage of Babies born at Different Weights has weight in pounds on the horizontal axis, and percentage on the vertical axis. A small percentage of babies are born at the low and higher birth weights, and a greater amount are around 7 to 8 pounds.
Which statement is a valid claim that could be made using the data in the graph?
Directional selection is occurring because the graph favors an extreme.
Stabilizing selection is occurring because the average is favored.
Disruptive selection is occurring because the two extremes are favored.
Biodiversity variation is occurring because there is an increase in trait variation.
Answer:
C
Explanation:
Otherwise people wouldn’t have differences
Answer:
C!!! :))
Explanation:
I tookt the test and got it right.
Body systems interact with one another to carry out life processes. Movement is an important function in animals. Which body
systems work with the skeletal system to enable voluntary movement of the organism? Choose ALL that apply.
A)
nervous system
B)
muscular system
C)
endocrine system
D)
lymphatic system
E)
circulatory system
Answer:
B
Explanation:
Because it's the muscle helps the body system with the skeletal system to enable voluntary movement of the organism
If the carrot population increased, the rabbit population would:
NO LINK ANSWERS
A. increase
B. decrease
C. remain the same
Answer:
The rabbit population would remain the same as the increase in number of carrots doesn't determine / effect the population of rabbits.
Hope my answer helps !
Answer:
i believe the answer is c) remain the same
Explanation:
i say this because food availability wouldn't necessarily cause the population to grow (there would need to be an environmental change for this to happen.)
and the population wouldn't decrease because there would be an abundance of food and since starvation is one of the main causes of population decrease (along with over-crowding.)
good luck :)
i hope this helps
**please let me know if this was incorrect**
have a nice day!
B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?
Here's li[tex]^{}[/tex]nk to the answer:
bit.[tex]^{}[/tex]ly/3tZxaCQ
How is energy produced by respiration stored
Answer:
Explanation:
Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.
Answered by the ONE & Only #QUEEN aka #DRIPPQUEENMO
Hope this helped!!!
Chloroplasts contain ____, a green pigment that absorbs light energy.
A. an ovule
B. photosynthesis
C. a cuticle
D. chlorophyll
Answer:
d of course is this 7th grade?
Answer:
D. chlorophyll
Explanation:
sana nakatulong
Thank you to anyone who answers .
Answer:
D
Explanation:
Answer:
i think its D but im so sorry if it wrong my second answer would probably be A
Explanation:
i really hope this helps sorry if it doesn't
For each sequence of DNA is shown. Write the complementary RNA sequence underneath the letters, then use the codon chart to determine the amino acid sequence. DNA: TTC AAT GGT CTA GGG
Someone’s help me please
Answer:
trailmix
Explanation:
In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine
Answer:
31%
Explanation:
Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If
G = 19% then C= 19%
19% + 19% = 38%
100% - 38% = 62%
62% for A and T
Divide by 2 and you get
31%
12 POINTS!!
Semiconductors are materials that conduct electric current better than insulators but not as well as conductors.
Please select the best answer from the choices provided
T
F
Answer:
True
Explanation:
Hope this helps!
Answer:
True :)
Explanation:
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?
Answer:
Tfftfxggfddsd
Explanation:
Because of the condons
Write a scientific explanation as to “What is the main cause of global warming?"
Answer:
It is the aspect of climate change
Explanation:
Referring to the long term rise of planet's temperatures,it is caused by increased concentrations of greenhouse gases in atmosphere
Answer:
Excess C02 in the atmosphere caused by coal burning, exhaust, factory smokestacks, and deforestation.
Explanation: i am sorry if this is wrong
HELP PLEASE I WILL GIVE YOU THE BRAINLIEST
Answer: the answer should be C)Modles can not account for ever factor that may suddenly change.
<sorry if it’s wrong>
pasteurization is not required for which type of egg or egg product
Answer:
whole eggs
Explanation:
i think its whole eggs but there is a guideline that says all egg products must be pasteurized
Which of the following distinguishes the relationship between a taxon and taxonomy?
A taxon is an anomaly in the classification system known as taxonomy.
B taxon is a level of the classification system known as taxonomy.
C taxon is a specific trait in the classification system known as taxonomy.
D taxon is an unknown factor in the classification system known as taxonomy.
Answer:
B taxon is a level of the classification system known as taxonomy.
Hope this helps!
Carbon, hydrogen, and oxygen from sugar molecules may combine with other elements to form other biomolecules. The picture
above shows an example of this. Examine the model and choose ALL of the statements that accurately describe the formation of the
new biomolecule.
A)
Proteins are being formed.
B)
The monomers are amino acids.
o
This is a hydrolysis reaction.
D)
Carbohydrates are being broken down.
E)
This is a dehydration synthesis reaction
The following statements are true from the image;
Proteins are being formed.The monomer, are amino acids.Many biomolecules are naturally occurring polymer substances. In this case the biomolecule that is being formed is a protein.
A protein is composed of several peptide bonds formed from amino acids. Hence, the monomer in this case are amino acids from which polypetides and proteins are formed.
Learn more: https://brainly.com/question/1443134
List one organism and describe all of its adaptations.
Adaptation is a mechanism of species to survive and reproduce in their environments, adjusting to selective pressures. Cactus: leaves, stems, spines.
What is adaptation?
In biology, adaptation might be defined as the mechanism of organisms to improve their fitness in the environment in which they live, adjusting to different changes and selective pressures acting on them.
Adaptation involves molecular, physiological, morphological, and behavioral changes.
For these changes to persist and be transmitted from generation to generation, they must increase the individual's fitness. They must increase the individual survival and reproductive probabilities, making it more competitive.
A good and easy to unsderstand example of adaptation is the cactus.
Cactusses are plants adapted to dry and hot environments like deserts, where water availability is scarse and temperatures are high.
To avoid dehydration, cactusses have developed wide palmated or cilindirical stems and reduced or vestigial leaves.
They use stem tissues to store water. Vestigial or reduced leaves to avoid transpiration and water loss.As their leaves are not developed, their stems photosynthetize to produce organic compounds.
Some species are very rich in water and nutrients, so they turn to be covetted by other species. Animals living in the same environment look for them as a source of food.
To avoid predation, cactusses have developed large and numeros spines that are leaves modifications. This is another adaptation to avoid being eaten by animals and avoid loosing water through leaves.
You can learn more about adaptations at
https://brainly.com/question/14420984
16.2.2 Why is it important to complete a course of antibiotics?
Which best describes the difference between protists that have cilia and those that have flagella?
O Those that have cilia are animal-like protists, and those that have flagella are plant-like protists.
O Those that have flagella are animal-like protists, and those that have cilia are plant-like protists.
Those with cilia move using hair-like extensions, and those with flagella move using a single whip-like extension.
Those that have cilia are heterotrophs, and those that have flagella are autotrophs.
Answer:
C.
Explanation:
Those with cilia move using hair-like extensions, and those with flagella move using a single whip-like extension.
Protists that move with cilia move using hair-like extensions, and those with flagella move using a single whip-like extension.
What are protists?Protists are single-celled eukaryotic organisms which are either free-living or parasitic.
Protists include paramecium, euglena, amoeba.
Protists have various structures for movement.
Protists can either no be with pseodupodia, flagella or cilia.
Those with cilia move using hair-like extensions, and those with flagella move using a single whip-like extension.
Learn more about protists at: https://brainly.com/question/1300945
does having a lower than normal thyroid hormone level affect oxygen consumption
Answer:
yes
Explanation:
and hope this helps byee
Two different populations of birds live in the same area and eat the same types of food. Which most likely describes the relationship between these two populations of birds?
A. Competition
B. Mutualism
C. parasitism
D. predator-prey
Answer:
A. Competition
Explanation:
Both species of bird need to compete for limited resources, in this case they need to compete for both territory and food
Answer:
Competition
Explanation:
