Answer:
excretion
Explanation:
Plz I will give brainliest
Please help ASAP! I have about 30 questions more to answer, so It would be so helpful if you answered this question. Thank you!
What do agriculture and urbanization have in common?
Answer:
Agriculture and urbanization both have the goal of expanding human value of living.
Explanation:
Answer:
Explanation:
Basically both of them benefit each other .
Urbanization brings major changes in demand for agricultural products both from increases in urban populations and from changes in their diets and demands. It can also bring major challenges for urban and rural food security.
Hope this helped !
The 1st organism in a food chain must always be what type of organism?
Answer:
Producer
Explanation:
I think it should be producer.
Answer:
Producer
Explanation:
The 1st organism in a food chain must always be what type of organism?
Producer
Chapter 1 Question: Why didn't the plants and animals in the biodome have
enough energy storage molecules?
Select the correct answer. A roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates. How much energy does the sandwich provide? A. 747 calories B. 542 calories C. 502 calories D. 367 calories E. 332 calories
Answer:
D. 367
Explanation:
If a roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates, it contains 367 calories of energy, hence option D is correct.
What is food energy?Animals obtain the chemical energy known as "food energy" from their food in order to maintain their metabolism, which includes their muscular activity.
The majority of animals get most of their energy via aerobic respiration, which involves mixing carbs, lipids, and proteins with air or water-based oxygen.
To find the total calories, multiply the given biomolecules grams with their calorie count.
= 42 × 4 + 7 × 9 + 34 × 4
= 168 + 63 + 136
= 367 calories
Therefore, the sandwich provides 367 calories of energy, if it contains 42 g protein, 7 g fat, and 34 g carbohydrates.
Learn more about energy, here:
https://brainly.com/question/839331
#SPJ5
What is the difference between a missense mutation and a silent mutation?
Danke schon! Ilysm <3
Answer:
Answer is in explanation
Explanation:
A silent mutation is a mutation in which a single nucleotide base is changed, but that change does not effect the amino acid sequence. A missense mutation is a point mutation in which a single nucleotide is changed, resulting in a codon that codes for a different amino acid.
The mutation is caused by the exchange of one base pair if no change in the overall protein (silence mutation), if there is change in one amino acid (missense mutation).
What is a silent mutation?A mutation is a difference in the DNA sequence of an organism.
Silent mutations happen when the difference of a single DNA nucleotide within a protein-coding portion of a gene does not influence the sequence of amino acids and the protein.
Thus, silent mutation has no change whereas stop mutation leads to termination of protein.
To learn more about mutation click here:
https://brainly.com/question/13923224
What valuable information was gained from Mendel's dihybrid crosses?
Select all that apply.
1. Not all traits are controlled by genes. In most plants, genes only determine traits that affect
flower color.
2. Statistical and probability methods can be used to determine how likely an offspring is to inherit
certain traits.
3. Genes are inherited differently in plants than they are in animals.
4. Inheritance of one trait does not affect inheritance of another.
Mendel's dihybrid cross proves that the inheritance of one trait does not affect the inheritance of another trait. Hence, option 4 is correct.
What is a dihybrid cross?When two different traits are crossed together then it is called a dihybrid cross. These two different traits are regulated by two different genes.
In Mendel's dihybrid cross, he did cross between round yellow and wrinkled grees. There are two traits, color, and shape. In the F1 generation, all seeds were round yellow but they were heterozygous. Round shape and yellow color are dominant traits.
Then he self-pollinated F2 generation and found four types of seeds that were round yellow, round green, wrinkled yellow, and wrinkled green in the 9:3:3:1 ratio. The cross is attached in the image below.
Inheritance of one trait does not affect the inheritance of another trait. Hence, option 4 is correct.
Learn more about dihybrid cross, here:
https://brainly.com/question/12540319
#SPJ2
Which molecule is produced in the aerobic breakdown of a glucose molecule?
A. Water
B. Oxygen
C. Light
D. Alcohol
E. NADPH
[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]
E. NADPH
thankshope it helpspls mark as brainliestAnswer:
E
Explanation:
it enters the citric acid cycle and generates reducing equivalents in the form of NADPH
3
ANNOTATE Write the inputs and outputs of cellular respiration on this diagram.
Answer:
Inputs---- glucose and oxygen.
Outputs----- ATP, carbondioxide and water.
Explanation:
The inputs of cellular respiration are the glucose and oxygen whereas the outputs of cellular respiration are energy in the form of ATP, carbondioxide gas and water. cellular respiration is a process in which glucose is broken down in the presence of oxygen gas for the production of energy in the form of ATP molecules. Carbondioxide gas and water which are the waste materials also produced in the end of cellular respiration process. Cellular respiration is the reverse of photosynthesis.
Please help biology
Answer: down
Explanation: bio teacher here
A.GL, Gl, gL, gl
B.GG, Gg. LL, Ll
C.GL, Gl
D.GG, Ll
Answer:
GL Gl gL gl
Explanation:
what is the complementary DNA of TACCGGATGCCAGATCAAATC?
Answer:
ATGGCCTACGGTCTAGTTTAG
Explanation:
A=T
C=G
G=C
T=A
This is the key to finding a complementary DNA strand.
Which organelle of a cell functions similarly to the envelope of a virus and why?
Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.
15 points answer please
Answer:
B
Explanation:
What are the five main phases of the cell cycle? What are the main events in each?
Answer:
In the adult organism, mitosis plays a role in cell replacement, wound healing and tumour formation. Mitosis, although a continuous process, is conventionally divided into five stages: prophase, prometaphase, metaphase, anaphase and telophase.
Cell cycle has different stages called G1, S, G2, and M. G1 is the stage where the cell is preparing to divide. To do this, it then moves into the S phase where the cell copies all the DNA.
Explanation:
good luck
please mark me as a brainliest
How are primary and secondary ecological succession similar?
1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.
Answer:
I don't know
Explanation:
I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?
1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.
Hold on, our servers are swamped. Wait for your answer to fully load.
What makes an isotope radioactive? Are all isotopes radioactive?
Answer:
Radioactive Elements
In elements with more than 83 protons, all of the isotopes are radioactive. ... The force of repulsion among all those protons makes the nuclei unstable. Elements with more than 92 protons have such unstable nuclei that they don't even exist in nature.
Explanation:
hope it helps you
follow me for more
I'm willing to help
Acid rain is caused by: *
*
O
a. Mass amount of CO2 in the atmosphere
O b. Reduction of pollutants
O c. Organisms that release acid into the atmosphere
O d. Planting more trees
Answer:
Mass amount of CO2 in the atmosphere
Lysogenic viruses do not
Answer:
Unlike a lytic virus, a lysogenic virus does not cause the host cell to lyse away. A lysogenic virus can remain inactive for a period of time. In lysogenic infection, viral DNA gets integrated with the host cell's DNA, where it is copied along with the host cell's DNA when the host cell replicates.
Explanation:
Help me PLEASEE!!! IT will mean alot
Answer:
I believe the answer is C.
Explanation:
Formula is Glucose + 6 Oxygen makes energy, 6 carbon dioxide molecules and 6 water molecules.
true or false
A niche includes just the biotic parts of an environment.
Answer:
False
Explanation:
An organism's niche includes its environment, behaviors, and interactions. It also includes its role within the environment. The environment consists of living and nonliving components.
The car shown below is trapped in cooled magma. Do you think that the guy in the car was in the car when the magma flowed from the eruption?
Answer:yes the car is stuck so yes he was in the car and he can’t get out
Explanation:
Tropical rainforests have the greatest biodiversity of any type of land ecosystem how does biodiversity contribute to the sustainability of an ecosystem
Biodiversity contributes to the sustainability of an ecosystem in ways such as biodiversity, ecosystem stability, ecosystem resilience, nutrient cycling, pollination, and medicinal properties.
Biodiversity is crucial for the sustainability of an ecosystem as it plays a significant role in maintaining the functioning of ecosystems and providing a range of ecological services. In tropical rainforests, which have the highest biodiversity, the presence of numerous species of plants, animals, fungi, and microorganisms contributes to the sustainability of the ecosystem in the following ways:
Ecosystem Stability: Biodiversity helps to maintain the stability of an ecosystem by providing a balance between predator and prey populations, nutrient cycling, and decomposition.
Ecosystem Resilience: The greater the biodiversity of an ecosystem, the more resilient it is to disturbances such as climate change, natural disasters, and human activities.
Nutrient Cycling: Biodiversity helps in the efficient cycling of nutrients in the ecosystem. Different species of plants and microorganisms play a role in decomposing organic matter, recycling nutrients, and maintaining soil fertility.
In summary, biodiversity is essential for the sustainability of ecosystems. It provides ecological services that are critical for maintaining the functioning of the ecosystem and contributing to human well-being.
To learn more about Biodiversity here
https://brainly.com/question/29765125
#SPJ1
Which two words best describe the Sun? Select one:
A)planet and gases
B)star and rocky
C) star and gases
D)planet and rocky
Answer:
I'm pretty sure it would be c
Explanation:
because it is a star so it definitely is not a or d and I don't think it is rocky soooo
dead cells are removed from the Dermis by phagocytosis. true or false?
what are the differences between ligaments & tendons
i need help with biology if you’re willing to help pls lmk :)
Answer:
sddssa
Explanation:sa
Which mammal does not give live birth whale sea cow duck-billed platypus kangaroo dog
Answer:
Duck-billed platypus
Explanation:
The duck-billed platypus is the only mammal that lays eggs.
explain how the genus and species name of an organism is properly written
Answer: The binomial system of nomenclature is structured so that the scientific name of a plant consists of two names: (1) the genus or generic name, and (2) the specific epithet or species name. ... The genus name is always underlined or italicized. The first letter of the genus name is always capitalized.
Explanation:
why do some scientists believe that humans evolved from apes?
a: because fossil records show homologous structures indicating a common ancestor
b: because humans and apes lived around the same time period
Answer:
A
Explanation:
Because it is way more logic