What
is a difference between systemic and pulmonary circulation?

Answers

Answer 1

Answer:

Systemic circulation carries oxygenated blood to the body and pulmonary circulation carries deoxygenated blood to the lungs.

Hope this helps!


Related Questions

A fossil of an extinct dinosaur is found, and the anatomy of the fossil shows similarities to that of a bird.
What possibly explains these similarities?

A. This is purely chance and isn't significant.

B. The extinct dinosaur and modern bird share a common ancestor.

C. All dinosaurs evolved into birds and that's why there aren't any dinosaurs alive today.

D. Dinosaurs choose to fly, and evolved into birds to escape predation and capture food.

Answers

Answer:

B sounds like a sensible choice

Explanation:

The extinct dinosaur and modern bird share a common ancestor. So the correct option is B.

What are evolutionary relationships?

Systematics, taxonomy, phylogenetics, and evolution are the four approaches used to investigate evolutionary connections. The branch of science known as systematics is concerned with classifying species and figuring out their relationships. It has two primary branches that may be separated:

Organisms are classified, given names, and grouped in taxonomy. A population, species, genus, or higher-level grouping like a family, order, class, phylum, kingdom, or domain can all be considered as a group or taxon. The word taxon is pluralized as taxa. The determination of evolutionary links or patterns of descent of species is via the study of phylogenetics.

The species of living things that exist now are all descendants of earlier ones. This is the result of evolution or merely time-related change. Branching evolutionary trees can be used to illustrate the evolutionary links between ancestors and their offspring. An evolutionary tree shows which ancestors gave rise to which descendants, much like your family tree does.

Therefore the correct option is B.

Read more about evolutionary relationships, here

https://brainly.com/question/14956690

#SPJ2

Explain how the discoveries by Rosalind Franklin helped Watson and Crick build an accurate model of DNA.How can DNA be used to help solve a crime?

Answers

Answer:

Rosalind Franklin had taken the first picture showing the structure of DNA, called the double helix. This helped confirm what Watson and Crick had thought, thus leading them to make the first accurate model. DNA can be used to solve a crime because it can prove a certain person did something. EX: finding hair and who it belongs to/ finding finger prints and who they belong to.

hope this helps!

PLEASE ANSWER ILL GIVE YOU BRAINLIEST

Answers

Answer:

3rd bubble

Explanation:

convergent boundary

Explanation: When two plate move towards each other they converge or come together. The collision between two plates that are moving towards each other is called a convergent boundary. When an ocean plate meets a continental plate at close to a straight line ( 180 degrees) the result is a subduction zone.

When the offspring's phenotype is a "combination" (mixture) of parents' phenotypes

A) Punnett square
B) Polygenic inheritance
C) Codominance
D) Incomplete dominance

Answers

Answer: C) Codominance

Explanation:

When the offsprings phenotype is a combination of both parents

Answer:

I think the answer is incomplete dominance!! my teacher just explained it

Explanation:

Evolution is a result of–
a. natural selection.
b. species not adapting quick
enough.
c. competition for resources.
d. harmful mutations.

Answers

Answer:

c

Explanation:

Give an example ecological disturbance. Light Disturbance? Extreme Disturbance.

Answers

Answer:

In contrast, major disturbances include large-scale wind events (such as tropical cyclones), volcanic eruptions, tsunamis, intense forest fires, epidemics, ocean temperature changes stemming from El Niño events or other climate phenomena, and pollution and land-use conversion caused by humans.

Explanation:

Imagine you are producing a short film depicting the molecules and biological processes involved in gene expression. For this, you need to first create a storyboard for your film. A storyboard is a sequence of drawings, along with some description or dialogue, that illustrates and represents the scenes of a story or movie. Create a storyboard for the process of gene expression/central dogma depicting the story of how the cell uses the information in DNA to synthesize a protein.

Answers

Answer:

By decoding information with the help of transfer RNA (tRNA).

Explanation:

The cell uses the information in DNA with the help of transfer RNA (tRNA) to synthesize a protein because transfer RNA (tRNA) decode a messenger RNA (mRNA) in order to produce proteins according to the information present in messenger RNA (mRNA). The information about protein is stored in a gene's DNA which is passed to a RNA in the cell nucleus which is responsible for formation of copies of DNA in the process of translation. So the cell uses the information of gene's DNA with the help of RNA molecules.

Create a typewritten paper describing the carbon cycle.
Describe the exchange of carbon through carbon-containing compounds between an
organism and the environment.
iii. Describe the contributions of photosynthesis and cellular respiration within and among
the four spheres. Discuss how carbon enters and leaves each of the four spheres and in
what forms.
Discuss the role of carbon storage in organisms
It only has to be one paragraph :)

Answers

Answer:

Plants reform the carbon into climatic carbon dioxide into carbon-containing organic compounds, such as sugars, fats, and proteins. Plants take in carbon dioxide by minute openings into their leaves, called stomata. They connect atmospheric carbon with water and produce organic compounds, utilizing energy trapped from sunlight in a method called photosynthesis. The by-product of photosynthesis is oxygen, which plants discharge into the atmosphere by the stomata.

Explanation:

Not positive if I'm right but it's the best answer I've got.

Leketa is a secret agent. She needs to send secret messages to her partner, Daniel. Leketa uses the sound waves from the beat of a drum to send her messages. Leketa and Daniel create a secret code using a pattern of drum beats to communicate with one another. In which of the following places would using a drum work to send her secret messages?
A. The drum will work on Earth, under the water, and in outer space.
B. The drum will work on Earth and under the water. The drum will not work in outer space.
C. The drum will work on Earth and in outer space. The drum will not work under the water.
D. The drum will work under the water and in outer space. The drum will not work on Earth.


Why did you choose your answer to Question 4? Explain in terms of sound waves.

Answers

Answer:

C.  The drum will work on Earth and in outer space. The drum will not work under the water.

---
Paar
ALGALEHEEN BILINGUAL SCHOOL
Grade 1 Science Homework #3.7
Topic 5.Lesson 4 Where plants and
animals live.
1.
A. True or false .
x
The environment is everything around a living thing
.
.​

Answers

Answer:

Explanation:

A habitat is a special place where a plant or animal lives

Answer:

True

Explanation:

Need help!!! asap due in a hour

Answers

You got all of them right if you need help with fourth one I can’t see it

How many mL of stock solution of 2M NaCl do you need to prepare 100 mL of 0.150M NaCl?​

Answers

Answer:

7.5mL

Explanation:

Comsidering the definition of dilution, 7.5 mL of the stock solution  of 2 M are required to prepare 100 mL of 0.150 M solution.

Dilution is a procedure by which the concentration of a solution is lowered. It is achieved by adding more solvent to the same amount of solute.

Then the amount of solute does not vary, but the volume of the solvent does: when more solvent is added, the concentration of the solute decreases, as the volume of the solution increases.

A dilution is mathematically expressed as:

Ci×Vi = Cf×Vf

where

Ci: initial concentration Vi: initial volume Cf: final concentration Vf: final volume

In this case, you know:

Ci= 2 M  Vi= ? Cf= 0.150 M Vf= 100 mL  

Replacing in the definition of dilution:  

2 M×Vi= 0.150 M×100 mL

Solving:

[tex]Vi=\frac{0.150 M x 100 mL}{2 M}[/tex]

Vi= 7.5 mL

In summary, 7.5 mL of the stock solution  of 2 M are required to prepare 100 mL of 0.150 M solution.

Learn more about dilution:

brainly.com/question/20113402?referrer=searchResults brainly.com/question/22762236?referrer=searchResults

Which statement provides the best explanation of the difference in biomass of organisms found at each trophic level?

Answers

Answer: organisms at higher tropic levels have less energy available to them in organisms at lower trophic levels

Explanation:

PLEASE HELP !! ILL GIVE 40 POINTS ; PLUS BRAINLIEST !! DONT SKIP ANSWER.

Answers

Answer:

the answer is a

Explanation:

its a physical reaction due to the change in apperance

It’s A
I hope it’s help

help guys pls !!!!!!?

Answers

Answer:

False

Explanation:

Please Brainliest

false!!!
i did that quiz!!

What are some Fun fact about elephant seal

Answers

Male elephant seals weigh as much as a small truck or cargo van.
Elephant seals spend up to 80% of their lives in the ocean.
They can hold their breath for more than 100 minutes – longer than any other non-cetacean mammal.
They can cover 60 miles a day when they head out to sea.

Hope this helps!

Recall in class the example of incorporating heavy or light nitrogen labels into DNA to investigate how DNA is replicated. Imagine if, instead of labeling DNA, the experiment used heavy labeled RNA bases. What would be the outcome if you examined the DNA strands after completion of DNA replication in the presence of heavy labeled RNA bases?

Answers

Answer: You would not notice any difference or any labeled base, because RNA is not used to make DNA.

Explanation:

DNA is a molecule that contains the genetic information in all living things. The molecule consists of two strands that wind around each other to form a double helix structure where the strands are joined by hydrogen bonds. It is a nucleotide polymer where each nucleotide consists of a sugar called deoxyribose, a nitrogenous base (which can be adenine, thymine, cytosine or guanine) and a phosphate group (derived from phosphoric acid). What distinguishes one polynucleotide from another, is the nitrogenous base and thus the sequence of DNA is specified by naming only the sequence of its bases. The sequential arrangement of these four bases along the chain is what encodes the genetic information.

Consider that DNA replication is semi-conservative, which means that each strand of the DNA double helix functions as a template for the synthesis of a new complementary strand.  This process leads from one starting molecule to two "daughter" molecules, in which each new double helix contains one new and one old strand. Then, if nitrogen tags are incorporated into the DNA, they will register on the old strand of the new DNA molecule.

On the other hand, RNA (ribonucleic acid) is a molecule similar to DNA but has only one strand and consists of a sugar (ribose) and alternating phosphate groups. Attached to each sugar is one of the four bases adenine, uracil, cytosine or guanine. The process of RNA synthesis, called transcription, consists of making a complementary copy of a piece of DNA. During this process, an enzyme called ARN polymerase, adds nucleotides that are complementary to the DNA strand. Then, this new RNA strand has new nucleotides. Thereby, if you examine the DNA strands after completion of DNA replication in the presence of heavy labeled RNA bases, you would not notice any difference or any labeled base, because RNA is not used to make DNA.

where do trees get nutrients to grow

Answers

Answer:

Photosynthesis a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's metabolic activities

they need sun water and CO2

Explanation:

So What are all the good things about parakeets that i can convince my dad to let me keep my 10 parakeets my mom got me

Answers

Answer:

They are cute, they can learn easily, you can train em, they're honestly good company, and uh- that's all I could think of :/

Explanation:

Have a nice day :) And I hope you get to keep your uh "birdies"

what is the outcome of cell signaling

Answers

Answer:

Other important large-scale outcomes of cell signaling include cell migration, changes in cell identity, and induction of apoptosis (programmed cell death).

Explanation:

what are 2 characteristics of s waves

Answers

Explanation:

s waves are shear waves. they move by material flexing or deformity sideways from the direction of waves travel

Rhesus monkeys are more closely related to rabbits than they are to horses. (B) Horses and cows have identical amino acid sequences in their cytochrome c. (C) Humans are more closely related to rabbits than they are to rhesus monkeys. (D) Plants and animals have no similarities at all. (E) Mammals are more closely related to reptiles than they are to fish.

Answers

Complete question:

A scientist used the amino acid sequence of cytochrome c in different species to consider evolutionary relationships.

The data below summarizes the numbers of differences in the amino acid sequences of cytochrome C found in the selected species

Species compared              Number of differences

Human-chimpanzees                              0

Human-Rhesus monkeys                        1

Human-Horses or Donkeys                    7

Human-Cow, Pigs or sheeps                  7

Human-Rabbits                                        7

Mammals-Birds and reptiles                  10-15

Mammals-Fishes                                    18-20

Mammals-Plants                                     45-48

Interpretation of the data supports which of the following statements?

(A) Rhesus monkeys are more closely related to rabbits than they are to horses.

(B) Horses and cows have identical amino acid sequences in their cytochrome c.

(C) Humans are more closely related to rabbits than they are to rhesus monkeys.

(D) Plants and animals have no similarities at all.

(E) Mammals are more closely related to reptiles than they are to fish.

Answer:

(E) Mammals are more closely related to reptiles than they are to fish.

Explanation:

So, what you need to do here is to compare the number of differences found in each comparison. Remember that this information is only regarding cytochrome C. For instance, we can see that between humans and chimpanzees, the number of differences is 0. Their amino acid sequences do not differ at all. On the contrary, the comparison of mammals and plants threw a value of 45-48 differences, meaning that they are very different from each other, almost 50%.

So, this is how you need to interpret the values of the differences in this table. Now, let us go to the options,

(A) Rhesus monkeys are more closely related to rabbits than they are to horses. Rhesus monkey was not compared to any group other than humans, so we could not say that they are more related to one animal or the other.

(B) Horses and cows have identical amino acid sequences in their cytochrome. When comparing humans with horses and then humans with cows, the number of differences was the same -7-. But these results do not indicate which are the differences. Remember that we are comparing amino acid sequences, so probably the number of differences of each group with humans is the same, but the amino acid sequences between horses and cows are not.

(C) Humans are more closely related to rabbits than they are to rhesus monkeys. Humans and rhesus monkeys express only one difference in the amino acid sequence, while humans and rabbits exhibit seven differences. This result means that humans are more closely to rhesus monkeys related than they are to rabbits.

(D) Plants and animals have no similarities at all.

As we mentioned before, plants and mammals have a difference of almost 50% in their amino-acidic sequences. It does not mean that the other 50% is also different.

(E) Mammals are more closely related to reptiles than they are to fish.

The amino acid sequence of mammals and reptiles show 10-15 differences

The amino acid sequence of mammals and fish show 18-20 differences

So yes, mammals seem to be more related to reptiles than to fishes because the number of differences with reptiles is fewer.

Plz help me well mark brainliest if you are correct!

Answers

Answer:

Explanation:

Uh this is gonna be kinda hard cause they are all examples of renewable resources. . .

but I would just say go with what the other pearson said :D

The first stage in the life cycle is called:

-prenatal.

-early childhood.

-middle childhood.

-infancy.

Answers

the answer is prenatal i think

Answer:

Infancy

Explanation:

From birth to age three, early childhood includes infancy and the toddler years. The remaining years of childhood are from the ages of four to eight, and this is when children start kindergarten. During this period of life, a variety of significant physiological and emotional changes occur.

What statement most directly demonstrates a way that the geosphere is involved in the nitrogen cycle? A. Fossil fuels form when decaying organisms are buried underground for long periods. B. Animals break down proteins and other nitrogen-containing compounds into waste products. C. Some plants absorb nitrogen from the air and use it to form proteins. D. Bacteria that convert ammonia into nitrites and nitrates are found in the soil.

Answers

Answer:bacteria that convert ammonia into nitrites and nitrates are found in the soil.

It on Plato

Answer:

bacteria that convert ammonia into nitrites and nitrates are found in the soil.

Explanation:

2. Which of the following is not used to study plate tectonics:
A) paleomagnetism
B) earthquake waves
C) sand dunes
D) fossils

Answers

Answer:

c) sand dunes

Which of the following best describes what causes plasma cells to form during a humoral immune response?
a. Memory B cells signal phagocytes to attack infected cells and divide, producing plasma cells.
b. Memory T cells recognize antigens and signal T lymphocytes to divide, producing plasma cells.
c. The antibodies on the surface of B cells bind to antigens, and the B cells grow and divide, producing plasma cells
d. The antigens on the surface of a pathogen attack healthy cells, and the resulting inflammation signals helper T cells to divide, producing plasma cells.​

Answers

Answer:

Explanation:

Answer:

C. The antibodies on the surface of B cells bind to antigens, and the B cells grow and divide, producing plasma cells.

Explanation:

I took the test

what gene combination will have 50% chance of occurring if two heterozygous black and chickens are mated 
please answer!!

Answers

It will be the one with capital and lowercase for example you will get (using Hh alleles for example)

(HH, Hh, Hh, hh)

So it will be the 2nd and 3rd combo, the heterozygous dominant it will have one dominant allele and one recessive

Which process involves wind moving loose sediment?
abrasion
deflation
impact
plucking

B- Deflation

Answers

B
idek what plucking is like what

Answer:

Deflation

Explanation:

Edge 2021


What is an example of biotechnology? What example from the Gene Editing article explains how biotechnology can be used for carbohydrates, lipids, and proteins?

Answers

Answer:

Synthetic insulin and synthetic growth hormone and diagnostic tests to detect various diseases are just some examples of biotechnology

Example of Gene Editing is Dalmatians, which often carry a genetic mutation that makes them prone to suffer from bladder stones.

?

Explanation:

HAVE A GOOD DAY

Other Questions
someone please help PLEASEE ZOOM IN TO READ THE QUESTION PLEASEE HELPa) 3/7b)3/10c)2/5d)1/2 Line A is perpendicular to Line B. If the slope of A is -1/7, what is the slope of Line B? What are some of the jobs that geographers have?? What tone is Wordsworth using with this word below (dancing)"Fluttering and dancing in the breeze." Which of the following describes the data set 6,8,13,15,21,23,31 Help please and thatn you plzzzzzzzzzzzzzzzz ill give more points PLZ HELPWhich is the sum of 3.15 10^7 +9.3 10^6 ? Write your answer inscientific notation.A. 4.08 10^7 B. 4.08 10^6 C. 0.408 10^8D. 40.8 10^6 GIVING BRAINIEST Select the expression that represents the following statement: 45 divided by one fifth the product of 3 and 5. (4 points)Group of answer choices45 (3 x 5 x one fifth )(45 one fifth ) x 3 545 ( one fifth x 3 + 5)45 one fifth x 3 x 5 Examine the phases of the moon at the top. The fourth image is replaced by a question mark. Which statement below correctly predicts the next stage of the lunar cycle? When trying to simplify and find the equivalent resistance you should first simplify resistors in _ before simplifying those in _ LOOK AT PIC! which table shows y as a function of x? Explain how the islands of Sicily and Sardinia positively impacted ancient Romans. Income statement under absorption costing and variable costingThe following information applies to the questions displayed below.Cool Sky reports the following costing data on its product for its first year of operations. During this first year, the company produced 42,000 units and sold 34,000 units at a price of $140 per unit. Manufacturing costs Direct materials per unit $60 Direct labor per unit $22 Variable overhead per unit $8 Fixed overhead for the year $504,000 Selling and administrative costs Variable selling and administrative cost per unit $12 Fixed selling and administrative cost per year $115,0001a. Assume the company uses absorption costing. Determine its product cost per unit. 1b. Assume the company uses absorption costing. Prepare its income statement for the year under absorption costing. 2a. Assume the company uses variable costing. Determine its product cost per unit.2b. Assume the company uses variable costing. Prepare its income statement for the year under variable costing. Fire: heat as night : darkness analogy luciana is adding water to a pool Jacob was assigned recently to a large team working on a major software release that was taking longer than expected. Jacob and the other latecomers into the project spent a month partnered with a senior programmer who went over the project in detail with them and got them up to speed. Unfortunately, this training put the project even farther behind schedule. After a few months of working on the project with many other programmers, Jacob's work output becomes noticeably lower than it was before when he was working independently. Jacob's reduced work output is most likely due to Help me out. Mathmatics someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include