What is the solution to this system of linear equations?

What Is The Solution To This System Of Linear Equations?

Answers

Answer 1

Answer: To solve a system of linear equations graphically we graph both equations in the same coordinate system. The solution to the system will be in the point where the two lines intersect. The two lines intersect in (-3, -4) which is the solution to this system of equations.

Step-by-step explanation: hope this helps


Related Questions

What is the growth (or slope) of the simplified equation??

Answers

Answer:i think its y+3x+8x-7

Step-by-step explanation:i dont have to explain

ABCD is a kite, so AC I DB and DE= EB. Calculate the length of AC, to
the nearest tenth of a centimeter.
B
с
E
A
4 cm
3 cm
4 cm

Answers

The length of the side AC will be equal to 5.69 cm

What is quadrilateral?

A figure consisting of four sides connected together and forming a total angle of 360 degrees is called a quadrilateral.

Given that:-

ABCD is a kite, so AC I DB and DE= EB.

AD = 4 cm BD = 4 cm and CD = 3 cm.

The side AC will be calculated as:-

Since AC is bisecting the line BD so BE = ED and BE = 2 cm and ED = 2 cm. WE have AD = 4 cm so we will calculate AE first by using the Pythagorean theorem.

AE² = AD² - ED²

AE² = 4² - 2²

AE² = 16 - 4 = 12

AE = √12 = 3.46 cm

Similarly, we will find the value of EC.

EC² = 3 ² - 2²

EC² = 9 - 4 = 5

EC = √5 =2.23

WE know that AC = AE + EC

AC = 3.46 + 2.23

AC = 5.69 cm

Therefore the length of the side AC will be equal to 5.69 cm

To know more about quadrilaterals follow

https://brainly.com/question/16691874

#SPJ1

Please help me! I need this done in 10 mins.

Answers

Answer:

I'm pretty sure the answer is 14m

Step-by-step explanation:

All you have to do is add the numbers together.

Hope this helps!

Answer:

The answer is 28.5

Step-by-step explanation:

Break apart the shapes then add their areas

Rectangle: 3 * 6 = 18

Top triangle: 6 * 2 = 12 / 2 = 6

Triangle on the right: 3 * 3 = 9 / 2 = 4.5

Total area = 28.5 meters squared.

If f(x) =- 2x + 5, find f(4x)​

Answers

Answer:

[tex]f(4x)=-8x+5[/tex]

Step-by-step explanation:

We are given the function:

[tex]f(x)=-2x+5[/tex]

And we want to find:

[tex]f(4x)[/tex]

So, by substitution, we acquire:

[tex]f(4x)=-2(4x)+5[/tex]

Multiply. So, our answer is:

[tex]f(4x)=-8x+5[/tex]

Help me with these two answers please

Answers

Answer:

Step-by-step explanation:

the center is at  (0, -2)

radius =  [tex]\sqrt{64}[/tex] = 8

Add 2 scores to the data set below so that the median does not change. List the two scores you used, and explain what must be true about the numbers that you would need to use
84, 73, 91, 61, 98, 88, 77

Answers

See the answer here is overspending. In order to discuss this you must repeat

on Tuesday, a local hamburger shop sold a combined total of 354 hamburgers and cheeseburgers. The number of cheeseburgers sold was two times the number of hamburger sold. How many hamburgers were sold on Tuesday?

Answers

Answer:

176

Step-by-step explanation:

can someone help i dont know any of these formulas

Answers

s.a=C.A xH

v of n.o.2 =lxwxh

Step-by-step explanation:

v of no.3=πr2h and s.a=πdh

no.1=area of cross section x area of all faces and v=area of cross section x length

try those ones

is y=1/4x+1/3 proportional or non proportional

Answers

Answer:

non proportional

Step-by-step explanation:

Can someone please help me answer this question asap thank you . No links please and thank you .

Answers

It’s a 10 to 1 relationship

4x + 21 < 17
PLS HELP ME MATES <3

Answers

Answer:

x < -1

Step-by-step explanation:

Give Brainllest plz mate

Answer:

x < -1

Step-by-step explanation:

subtract 21 from 17

divide on both sides by 4

sorry if this isn't what you're asking

A population of mutant Venus fly trap plants are taking over an island in the South Pacific, capturing everything from insects to small rodents

Answers

The question is incomplete. The complete question is :

A population of mutant Venus fly trap plants are taking over an island in the South Pacific, capturing everything from insects to small rodents. When they were first discovered they covered 4 square kilometers. As the population grows, the plants spread and cover more land. Use the table to write an equation.

Solution :

It is given that:

Venus fly trap plant  is capturing everything on its way from small insects to other small rodents.

When they were first discovered, it covered an area of 4 square kilometers. But as more population grew and as years passed by, they spread over large land and covered more land.

Now from the table, it is seen that :

It covered 4 km square when discovered.

Then it covered 6.68 km square in the first year.

It covered 11.16 km square in the second year.

It covered 18.63 km square in the third year.

It covered 31.11 km square in the fourth year.

Therefore the equation which represents the growth is given by :

[tex]$y=4(1.67)^x$[/tex]

what does this integral unit mean? ​

Answers

Answer:

Every time a new piece of equipment is added to the system, if ifs not properly optimized within the scope of the entire system, you'll end up with wasted energy and operational inefficiencies

Answer:its an integral where the function to be integrated is evaluated along a curve. Various different line integrals are in use. In the case of a closed curve it is also called a contour integral. The function to be integrated may be a scalar field or a vector field.

Step-by-step explanation:

hope this helps

a board game cost d dollars. the sales tax rate is 8%. what two expressions can be used to calculate the total cost for the game, including tax?

Answers

Answer:

The equation for the amount of tax (8%) T on an item that costs P dollars is:

T=0.08P

Step-by-step explanation:

Please write eight facts about: The Flow of Energy in a Food Chain.
_________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Answers

Answer:

Always linear...

Decreases with successive trophic level

Answer:

Food chains are very important for the survival of most species. When only one element is removed from the food chain it can result in extinction of a species in some cases.An example of a simple food chain would be: A plant grows using the sun's energy and nutrients from the soil. A rabbit eats the plant. A fox eats the rabbit. The fox dies and decomposes into organisms that feed the soil.A producer, which is able to produce its own food, is also called an autotroph. Every species in the ecosystem relies on producers for their existence.A producer is able to covert inorganic compounds into organic compounds. Without this process life could not exist.A producer can use either solar energy or chemical energy to convert organisms into usable compounds.Because the sun is necessary for photosynthesis, life could not exist if the sun disappeared.Consumers can be carnivores (meat eater only), herbivore (plant eater only), omnivore (eats animals and plants), and a scavenger (eats dead animals).Examples of omnivores (plant and animal eaters) are bears (which eat fish, insects, honey, moose, and grass), turtles (which eat crayfish, earthworms, lettuce, and algae), squirrels (which eat seeds, fruit, eggs, and insects), and monkeys (which eat fruit, leaves, and frogs).Examples of carnivores (animal eaters) include hawks, snakes, foxes, and spiders.Examples of herbivores (plant eaters) include rabbits, moose, cows, groundhogs, and grasshoppers.Decomposers, which feed on dead animals, break down the organic compounds into simple nutrients that are returned to the soil. These are the simple nutrients that plants require to create organic compounds.It is estimated that there are more than 100,000 different decomposers in existence.Al-Jahiz was a 9th century scientist who is responsible for introducing the concept of food chains.The food web, which is a concept that expands on the food chain, was introduced in 1927 by Charles Elton.Food chains can be short, or they can be long, depending on how many consumers can be eaten before one dies and begins to decompose.If a food chain were to continue too long, the energy would become less and less and it would not be very valuable to the animal at the end.

Step-by-step explanation:

Enter the correct value so that each expression is a perfect-square trinomial.
x2+___x + 36

Answers

I believe the answer would be 12.

Answer:

It's 100% 12

Step-by-step explanation:

What is the diameter of a circle go through

Answers

Answer:

The diameter of a circle passes through the center of the circle and has its endpoints on the circle itself. The diameter of any circle is two times the length of that circle's radius.

Step-by-step explanation:

To find the diameter of a circle, you need to know the radius of the circle, double it to get the diameter. The radius is the distance from the center of the circle to its edge. If the radius of the circle is 4 cm, then the diameter of the circle is 4 cm x 2, or 8 cm. If you know the circumference of the circle, divide it by π to get the diameter.

What is the residual of a customer with a height of 155 cm who rents a bike with a 51 cm frame?

cm

Answers

Answer:

Step-by-step explanation:

What is the residual of a customer with a height of 155 cm who rents a bike with a 51 cm frame?

cm

Answer:

Step-by-step explanation:

-1

PLEASE HELP!!!

sin 0 = 9/41. Find tan 0.​

Answers

Answer:

B. 9/40

Step-by-step explanation:

just got the answer

The value of the tanθ is 9/40 after applying the Pythagoras theorem option (C) 9/40 is correct.

What is trigonometry?

Trigonometry is a branch of mathematics that deals with the relationship between sides and angles of a right-angle triangle.

We have a trigonometric ratio:

As we know, the trigonometric ratio is defined as the ratio of the pair of a right-angled triangle.

sinθ = 9/41

sin is the ratio of the side opposite to the hypotenuse.

From the Pythagoras theorem:

Adjacent side² = hypotenuse² - opposite²

Adjacent side² = 41² - 9²

Adjacent side = 40

tan is the ratio of the side opposite to the adjacent

tanθ = 9/40

Thus, the value of the tanθ is 9/40 after applying the Pythagoras theorem option (C) 9/40 is correct.

Learn more about trigonometry here:

brainly.com/question/26719838

#SPJ2

Please help, this question makes no sense

Answers

Answer:

5.4 units

Step-by-step explanation:

The diagonal AC has length

|AC|  =  √(2² + 5²) = √29 ≈ 5.4 units.

The horizontal distance from A to C is 2 units; the vertical distance is 5 units.  That's where the 2² and 5² come from.  

2x + 5 = 15 Check:






please and thank you ​

Answers

Answer:

[tex]x=5[/tex]

Step-by-step explanation:

VERY EASY


Choose the correct simplification of the expression (a^2 multiplied by b^5)^3

A^6/b^15

A^5/b^8

A/b^15

A^6/b^11

Answers

Answer:

1

Step-by-step explanation:

the first one because if you take the expression that you want, and expanding it out, you will get the first one.

Answer:

A

Step-by-step explanation:

(a^2)^3 (b^5)^3

The powers multiply when written like this. They don't add.

a^6 b^15

A

A function f(x) has x-intercepts of -3 and -5. What is the constant term in the function?
f(x) = x2 + 8x +

Answers

Answer:

15

Step-by-step explanation:

The x-intercepts -3 and -5 are also "roots" of the polynomial.  The corresponding factors are (x + 3) and (x + 5).  Multiply the constants together:  3*5 = 15.  This is the desired constant term.

Note that your f(x) = x2 + 8x +   should be written   f(x) = x^2 + 8x +       ...    The " ^ " denotes exponentiation.

Check:  Multiply (x + 3) and (x + 5) together and compare the result to the given polynomial with constant term 15:

f(x) = (x + 3)(x + 5) = x^2 + 3x + 5x + 15 = x^2 + 8x + 15.  This matches!

Answer:

Step-by-step explanation:

find the area of parallelogram

Answers

Answer:

45m

Step-by-step explanation:

9*5

Please help! Write at least 2 sentences!
What do you know about 2 points that have opposite x-coordinates?

Answers

Answer:

They will mirror each other, but only if they have the same y value. Otherwise they will simply be on opposite sides of the Y line.

Hope this helps :)

how do i find the range of a function on a graph

Answers

Answer:

#1. First label the function as y=f (x) #2. Express x as a function of y #3. Find all possible values of y for which f (y) is defined y y. #4. Element values of y by looking at the initial function f (x)

Step-by-step explanation:

please help help help help help​

Answers

Answer:

y = - 6

Step-by-step explanation:

Locate x = - 7 on the x- axis, go vertically down to meet the graph at (- 7, - 6)

Then output is y = - 6 when input is x = - 7

PLES HALP POINTS PIC DOWN BELOW

Answers

Answer:

The answer is D

Step-by-step explanation:

Answer:

D) Quadrant IV (quadrant 4)

Step-by-step explanation:

Point C is in quadrant IV because its point is (4,-4)

For points that have a positive x-coordinate and a negative y-coordinate, that means they are in quadrant IV.

Another way to figure this out is by looking at this graphically:

                                    y

                                    |

         Quadrant           |          Quadrant

                II                  |                 I

                                    |

 ------------------------------|----------------------------- x

                                    |

          Quadrant          |           Quadrant

                III                 |                 IV

                                    |

I hope this helps!

Can you please help I’m failing bad

Answers

Answer:

1. 3

2. depends on the lenght of each cube i dont know so just multiply it with 3

3. same here or by 2 i dont know which side to get the width of sorry

4. 9

Step-by-step explanation:

Find 5 Rational Numbers Between 1 and 2 using (a+b/2) where a=1 and b=2.

Answers

Answer:

There are two ways to find the rational number between any two numbers. I will tell you an easy method to find it.

As we have to find 5 rational numbers between 1 & 2

Take 5 and add 1 to it i.e. 5+1= 6

Now take the first number and multiply and divide it by 6 i.e.

1x6/6 = 6/6

Also take the second number and multiply and divide it by 6 i.e.

2x6/6= 12/6

This is done to convert 1 & 2 into rational number i.e. in form of p/q

Now we have two numbers 6/6 and 12/6 so five rational numbers between them are

7/6, 8/6, 9/6, 10/6, 11/6

The values of these number you can check will be between 1 & 2. Actually between any two number there are infinite number of rational numbers.

Other Questions
What keys on the keyboard have the ability to move the cursor around on a window?No links and files or I report!Will give Brainliest! Write two equivalent area to represent the perimeter of this rectangle. 5 X-2 I NEED EXAMPLES! GIVING BRAINLIEST!Do you belong to a group of some kind? Your family, a sports team, or a school club? Do you think the groups you belong to form your identity? Why or why not?Answer in 3-4 sentences. What is the value of y in the parallelogram below During the primary election process, which of the following activities is a partys main focus? A. uniting to support candidates in the general election B. selecting candidates to represent the party in the general election C. promoting the partys message in comparison to other parties D. defeating competing candidates from other political parties Please select the best answer from the choices provided A B C D Mark this and return The function f(x) = 600(0.981)x, where x is the time in years, models a declining lemming population How manylemmings will there be in 3 years?A.about 566B.about 1,803C.about 1,766D.about 601 John Jay represented ______ inthe First Continental Congress.A. BostonB. AtlantaC. New York Which level of government is allowed to conduct trials for treason?federal governmentOstate governmentO local governmentall levels of government The central government working with the state and local governments in an example of a _________________ system of government. Which word is spelled correctly? How do we teach boys to grow up to be men who respect women, and how do we teach girls to grow up and find a respectable man? Help pls thanks!!!!!!!!! Use the function below to find F(2).F(t) = 2x1/2^3t. 1/32O B.1/8O c.1/16OD.1/64 Can anyone figure this out? NO LINKS OR FILES . What event causes Lily to realize Rosaleen really loves her?A. Rosaleen stands up to T. Ray for Lily's pet. B. Rosaleen rescued Lily from a rabid dog.C. Rosaleen tells Lily "Happy Birthday!"D. Rosaleen asked to adopt Lily.The book is Secret life of bees. 100 POINTS AND A BRANILIES NO LINKS AND NO CRAZY ANSWER PLEASE FOLLOW THE DIRECTIONS choose your recipe and simplify the longer sentences into basic steps (make sure you have 5 positive commands and 2 negative commands). You may have to add some negative commands into the recipe if there aren't any what is the mRNA in TACCGGATGCCAGATCAAATC? What is the measure of A, the exterior angle of the triangle shown below?F. mA = 92, because 180 (50 + 38) = 92.G. mA = 272, because 180 (50 + 38) = 92 and 92 + 180 = 272. H.mA=78,because 5038=12and9012=78.J. mA = 88, because 50 + 38 = 88. One of the biggest challenges that we all face, at least inmy opinion it's a challenge, is making difficult decisions,life-altering decisions. These decisions are not onlydifficult to make, but they can also bring consequencesthat are not easy to live with. However, if decisions are wellthought out and carefully considered they will be easier tomake and easier to live with.What feedback would be most helpful feedback to give the writer of thisparagraph?A. Improve the spelling and grammar.B. Make the claim more personal.C. Revise the claim to make it clearer.D. Address a counterclaim. What is the surface area of the figure? 408ft^2 458ft^2 545ft^2 720ft^2