What is the process of the digestive system?

Answers

Answer 1

Answer:

In terms of processes: ingestion, motility, mechanical digestion, chemical digestion, absorption, and defecation.

In terms of pathway: Mouth, throat, esophagus, stomach, small intestine, large intestine, rectum, and finally the anus.


Related Questions

What is the main function of leaves?A. Leaves provide support for growth and a place to store food.B. Leaves provide a place for photosynthesis to occur.C. Leaves absorb water and minerals and transport nutrients to the stem.D. Leaves create a barrier that prevents water in the plant's tissues from evaporating

Answers

Answer:

B

Explanation:

The main function of a leaf is to produce food for the plant by photosynthesis.

Answer:  The correct answer is B. Leaves provide a place for photosynthesis to occur.

Explanation:  Confirmed correct.

FOR 100 POINTS AND I WILL MARK BRAINLIEST!!!!!

Horses have three basic coat colors: red (or chestnut), bay, and black. All the colors are controlled by the interaction of two genes, Extension (E) and Agouti (A). The following combinations produce bay color: EE/Aa, Ee/Aa, EE/AA, Ee/AA. Only two produce black color: EE/aa, Ea/aa. Other combinations of the alleles of these genes plus mutations of others result in many possible coat colors and patterns in horses

Coat color in horses is an example of which type of inheritance?

(1 point)

A. polygenic inheritance

B. dominant inheritance

C. Mendelian inheritance

D. recessive inheritance

Answers

Answer:

A. Polygenic inheritance

Explanation:

When the qualities or the attributes are passed from the parent to their progeny is called inheritance. It can be passed either sexually or asexually.

The correct answer is:

Option A. Polygenic inheritance

This can be explained as:

When a trait is regulated by two or more genes is called polygenic inheritance.

Dominant inheritance occurs when the qualities from the parent possessing the dominant gene pass to the progeny.

According to Mendelian inheritance paired genes assorts independently and are passed from parent to their progenies.

Therefore, coat colour in horses is an example of polygenic inheritance.

To learn more about polygenic inheritance follow the link:

https://brainly.com/question/22923

_______ Which nutrients should we limit and eat less to promote good health?
a. protein, sugars and total fat
b. sugars, fiber and total fat
c. total fat, cholesterol and sodium

Answers

c. total fat, cholesterol and sodium

I think the correct answer is B or C

which statement best describes an example of selective breeding?​

Answers

Answer: the answer is A

Explanation:

Which of the following resources are used the most in the US.

Coal
Natural Gas
Oil
Nuclear Energy
Solar
Wind
Hydropower
Geothermal
Biomass/biofuel

Answers

Oil, coal and natural gas my guy

Hope that helps

Which of the following best describes natural selection?

A. organisms vary in their physical traits, and some are inherited

B. Organisms compete for food and shelter

C. organisms best suited to their environments are most likely to survive and reproduce

D. Organisms produce more offspring than can survive

Answers

Answer: C

Explanation: according to Darwin, out of the vast no of individuals which compete for a place in the world, only those having advantageous variations survive and reproduce
C remember the key word is natural

A group of students wants to study the structures of animals in the desert. One question they should ask is-
How long do the animals live?
Can you buy the animals in pet stores?
How do the animals satisfy their need for water?
How many offspring do the animals have?

Answers

Answer:

Jdjdjdj

Explanation:

Animals survive in deserts by living underground or resting in burrows during the heat of the day. Some creatures get the moisture they need from their food, so they don't need to drink much water, if any. Others live along the edges of deserts, where there are more plants and shelter.

Even though deserts don't get much rain, the desert is a habitat for some plants and animals. Each species has adapted to be able to live in a range of temperatures and without much water. ... Animals that live in deserts include lizards, geckos, toads, jackrabbits, camels, snakes, spiders and meerkats.

Worth 26 points! Help me please! Do 1,2,3 by filling in the blank!!!! And I will make you brainest!
And don’t answer just to get points or I am reporting you

and no website

Answers

Answer:

Glucose is the word!!

islfso lufe
(Hint: a non-renewable resource, like coal)
CHAPTER
1 what is the term?

Answers

Answer:

Fossil fuel

Explanation:

Which of the following are parts of a bacterial cell?

Select all that apply.

mitochondria
flagella
cell wall
pili

Answers

Answer:

It is a gel-like matrix composed of water, enzymes, nutrients, wastes, and gases and contains cell structures such as ribosomes, a chromosome, and plasmids. The cell envelope encases the cytoplasm and all its components. Unlike the eukaryotic (true) cells, bacteria do not have a membrane enclosed nucleus.

Explanation:

Flagella, cell wall, and pili are parts of a bacterial cell.

What is a bacterial cell?

Microscopically small, single-celled creatures known as bacteria are found in millions in every habitat, both within and outside of other living things.

Some bacteria are hazardous, but most serve a helpful role. They are employed in industrial and medical procedures and sustain a wide variety of living forms, including both plant and animal life.

Around 4 billion years ago, bacteria are assumed to be the initial lifeforms to emerge on the planet. The earliest fossilized creatures are bacteria-like ones. Most biological and some materials can be used as food by bacteria, and certain strains can withstand harsh environments.

New insights into the functions of the gut microbiome are being provided by this expanding interest in how microorganisms affect human health. Bacteria are prokaryotes that do not contain any membrane-bound organelles.

Therefore, flagella, cell wall, and pili are parts of the bacterial cell.

Read more about the bacterial cells, here

https://brainly.com/question/21141798

#SPJ2

deposits of coal have been found beneath the ice of Antarctica. But coal only forms from warm swamps. How can coal be found so near the South Pole?

Answers

Deposits of coal have been found beneath the ice of Antarctica. But coal only forms in warm swamps. ... According to Wegener's hypothesis, coal could be found near the South Pole because during the time of Pangaea, the South pole was near the equator causing it to be warm and allowing coal to form.



Hope it helps

Which of the following are characteristics of
Zygomycota? Check all that apply.
D
lack reproduction phase
spores produced in basidia
spores produced in zygosporangia
important in the food industry
important in the fermentation process
can cause disease to plants
can cause disease to animals

Answers

Answer: 3- spores produced in zygosporangia

5- important in the fermentation process

Explanation:

Answer:

in the picture

Explanation:

Chlorophyll is essential to photosynthesis because it traps the _______________ needed. A. oxygen B. carbon dioxide C. sunlight D. water

Answers

Answer:

sunlight

Explanation:

cawg

Answer:

C. sunlight

Have a good day

HELP right now please! No websites

Answers

Carbon dioxide is the name of the molecule I believe
CO2. Carbon Monoxide

A student claims that the only difference between prokaryotic cells and eukaryotic cells is that
eukaryotic cells have a nucleus, but prokaryotic cells do not. What is wrong with this claim?

The description of the cell types is incorrect.

Prokaryotic cells have a nucleus, and eukaryotic cells do not.

The description of the cell types is incorrect. Both prokaryotic and eukaryotic cells have a nucleus.

There is another difference between the cell types. Eukaryotic cells have membrane-bound organelles, but
prokaryotic cells do not.

There is another difference between the cell types. Eukaryotic cells have a cell membrane, but prokaryotic
cells have a cell wall instead.

Answers

Explanation:

Eukaryotic cells:

• There is a well defined nucleus

• They are membrane bounded cell organelles like chloroplast, golgi bodies, mitochondria.

Prokaryotic cells:

• The nucleus are not well defined

• Cell organelles are not bounded by membrane

Please help!!

Explain why it would be financially beneficial for a farmer to treat a fruit crop with gibberellins.

Answers

Answer:

Gibberellins can promote flowering, which can result in more financially profitable flowers to sell due to the increased speed of flower growth. More attractive flowers and larger specimens are also produced. Flowering also has an impact on the rate of fruit growth.

Explanation:

what can a negative consequence of humans being hunter-gatherers?

A. they needed to stay in one location for food

B. Nate cultivated their own food

C. they had to move around to find food

D. they had to have large families to help on the farm​

Answers

Answer:

C

Explanation:

Marcus grew three rosemary plants. He put one in
direct sunlight, one in the shade, and one in the
dark. The plant in the sun grew the most quickly
and looked the healthiest. Marcus concluded that
rosemary plants grow best in the sun.
How would you evaluate Marcus's conclusion?
O A. His conclusion is valid because his
experiment included a control.
B. His conclusion is valid because he tested
only one variable.
O C. His conclusion is flawed because he did
not perform enough trials.
O D. His conclusion is flawed because it is
based on the appearance of the plants.

Answers

Answer:

His conclusion is flawed because he did

not perform enough trials.

Explanation:

i jus took the test

A person who is interested in finding a cure for diabetes, in which the pancreas does not produce insulin, might pursue a career in A.Endocrinology B.Gene therapy C.Neuroscience D.Sports medicine 2 See answers

Answers

Answer:

The answer is: A.

Explanation:

A person who wants to find a cure for diabetes might pursue career in  endocrinology. Endocrinology is a branch of biology and medicine dealing with endocrine system and diseases that occur due to hormonal disorders, and disorders of the hormone secretion. The disorder of insulin secretion hormones causes diabetes, and this hormone produces pancreas. In addition, endocrine disorders can be, growth disorder in children, adrenal gland disorders, testosterone levels disorder, etc.

HELP PLEASE I WILL GIVE BRAINLIEST

Answers

Explanation:

A is the correct answer in my opinion. Thanks.

I think A as well :)

Causes of gonorrhea
Please list 3 causes

Answers

Gonorrhoea is a sexually transmitted infection (STI) caused by bacteria called Neisseria gonorrhoeae or gonococcus. It used to be known as "the clap
Four causes of gonorrhea are;
Vagina
Throat
anus.
female reproductive tract (the fallopian tubes, cervix, and uterus)
sexual contact, including oral, or vaginal intercourse

What is the function of the structure identified by the red arrow?

Mobility
Protection
Reproduction
DNA transfer

Answers

Answer:

I'm not entirely sure, however, since no one has answered your question yet, I'll say A. Mobility

This thing probably moves around, and it doesn't look like it could protect it, or anything.

Answer:

The answer is Mobility.

Explanation:

Took the test.

PLEASE HELP WILL MARK BRAINLIST The group of animals (a pod of orcas) shown below is an example of What level of organization? Community Population Ecosystems Individual​

Answers

Answer:

The answer is likely population or community

Explanation:

the reason that it is not an ecosystem is because an ecosystem is more than just than group of animals itself it also includes the water and things growing underneath it. The reason that it is not an individual is because there is more than one there (a group).

Explain how a school bus uses all of these energy types.

-Mechanical
-Chemical
-Electrical
-Thermal

Answers

Answer:

Mechanical

94 percent of all school buses in America are powered by diesel engines because of their reliability, durability and safety. Almost half of these (46 percent) rely on the cleanest, near-zero emission diesel engine technology.

Chemical

school bus uses petroleum as chemical potential energy.

Electrical

An electric bus draws electricity from the power grid and stores it in a battery that can be recharged once the electricity has been used up. This basically mirrors the way our electronics work. We plug them in and let the battery charge and then use them wirelessly until it's time to charge again

Thermal

They heat the cold coolant from engine's block to 160° F in as little as one hour, then pump it back to the vehicle's engine and heat exchangers. The result: engine is preheated and the vehicle's heat exchangers distribute an abundance of heat to the vehicle's interior.

Why does the ability to lay 1,000 to 5,000 eggs increase the fitness of the species L. clamitans clamitans?


It increases the probability that moving water will promote gene flow from one population to another.

It increases the chance of the recombination of alleles, leading to genetic drift in the population.

It increases opportunities for offspring to compete for limited resources.

It increases the probability that some offspring will survive long enough to reproduce.

Answers

Answer:

increases opportunities for offspring to compete for limited resources.

how forests can be better managed ?

Answers

Forests that are healthy and diverse can cope best with such threats and continue to act as forests. Water quality and quantity in forest habitats should be maintained or improved. Soil fertility should be maintained or increased, and soil degradation and pollution should be avoided.

How much water on Earth is salt water?

Answers

Answer:

97 percent

Explanation:

Science

Answer:

below

Explanation:

Over 97 percent of the earth's water is found in the oceans as salt water. Two percent of the earth's water is stored as fresh water in glaciers, ice caps, and snowy mountain ranges. That leaves only one percent of the earth's water available to us for our daily water supply needs.

what did humans evolve from I am creating a a evolution chain I know this can be considered a unintelligent question I am just not positive on what we evolved from

Answers

Answer: Human evolution, the process by which human beings developed on Earth from now-extinct primates. Viewed biologically, we humans are Hono Sapines, a culture-bearing upright-walking species that lives on the ground and very likely first evolved in Africa about 315,000 years ago.

Human evolution is not linear manner it is a web, in the process of evolution primates lead to the emergence of homo-sapiens, which is distinct from the hominid family.

How did humans evolve?

Human evolution is observed in a web manner not linear in evolutionary history primates lead to the homo-sapiens which is distinct from another family of hominids.

The hominid family includes great apes that diverged from the gibbons 15-20 million years ago. Evolution involves some studies, genetic studies, and h behavioral studies.

Anatomically it is observed in Africa 300000 years ago humans appeared, these studies were observed anatomically as the origin of humans.

Therefore human evolution is observed in a web manner not linear.

Learn more about human evolution, here:  

https://brainly.com/question/24276894

#SPJ2

Which is not a reason for biodiversity in an ecosystem.

A. Organisms can adjust to environmental changes

B. The ecosystem provides a variety of food for organisms

C. Water scarcity

Answers

Answer:

C

Explanation:

it's water scarcity because biodiversity is variation among a group of populations. water scarcity would kill out animals and diminish biodiversity in an area

Answer:

C. Water scarcity

Explanation:

Hope you have a great day :)


What does "reliably" mean in these sentences?

Answers

Answer:

it would be the top right one

Answer:

in a way that can be trusted

Explanation:

hope this helps!

(no reporting nor deleting this.)

Other Questions
GIVING BRAINIEST Select the expression that represents the following statement: 45 divided by one fifth the product of 3 and 5. (4 points)Group of answer choices45 (3 x 5 x one fifth )(45 one fifth ) x 3 545 ( one fifth x 3 + 5)45 one fifth x 3 x 5 Examine the phases of the moon at the top. The fourth image is replaced by a question mark. Which statement below correctly predicts the next stage of the lunar cycle? When trying to simplify and find the equivalent resistance you should first simplify resistors in _ before simplifying those in _ LOOK AT PIC! which table shows y as a function of x? Explain how the islands of Sicily and Sardinia positively impacted ancient Romans. Income statement under absorption costing and variable costingThe following information applies to the questions displayed below.Cool Sky reports the following costing data on its product for its first year of operations. During this first year, the company produced 42,000 units and sold 34,000 units at a price of $140 per unit. Manufacturing costs Direct materials per unit $60 Direct labor per unit $22 Variable overhead per unit $8 Fixed overhead for the year $504,000 Selling and administrative costs Variable selling and administrative cost per unit $12 Fixed selling and administrative cost per year $115,0001a. Assume the company uses absorption costing. Determine its product cost per unit. 1b. Assume the company uses absorption costing. Prepare its income statement for the year under absorption costing. 2a. Assume the company uses variable costing. Determine its product cost per unit.2b. Assume the company uses variable costing. Prepare its income statement for the year under variable costing. Fire: heat as night : darkness analogy luciana is adding water to a pool Jacob was assigned recently to a large team working on a major software release that was taking longer than expected. Jacob and the other latecomers into the project spent a month partnered with a senior programmer who went over the project in detail with them and got them up to speed. Unfortunately, this training put the project even farther behind schedule. After a few months of working on the project with many other programmers, Jacob's work output becomes noticeably lower than it was before when he was working independently. Jacob's reduced work output is most likely due to Help me out. Mathmatics someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others. Which detail from paragraphs 22-25 best supports the concept of the "democratization" of social media in paragraph 22?A "mainstream media and institutions tend to invisibilizewomen, Howard says, the truth is getting more and moredifficult to ignore as these women so visibly lead the charge (Paragraph 22)B "they're working on a Juneteenth celebration with food trucks, speakers and performers - something to bring people together as the nation commemorates the end of slavery" ( Paragraph 23)C "Thomas anticipates she'll be busy organizing more events throughout the summer" (Paragraph 24)D "We're going to be dedicating our time to this to make sure things actually happen, Thomas says." ( Paragraph 25) Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down How does learning a different language helps you with communication skills find the area of the triangle answer in digital format only Malcolm is filling bags with rice. He starts with a 5 1 over 4 pound container of rice and fills eachbag with pound of rice. How many bags of rice can Malcolm fill?