the sum of the three sisters' ages is 51. If ava is 6 years older than
Camila, and Camila is twice as old as Luna, what are the ages of the
three sisters?

Create an equation with only one variable.

Answers

Answer 1

9514 1404 393

Answer:

Luna is 9Camila is 18Ava is 24

Step-by-step explanation:

We can express all of the ages in terms of Luna's age. Letting L represent Luna's age, we have ...

Luna's age: LCamila's age: 2LAva's age: 2L +6

The total of their ages is then ...

  L +2L +(2L+6) = 51 . . . . an equation with one variable

  5L = 45

  L = 9

Luna is 9, Camila is 18, and Ava is 24.


Related Questions

Plz answer I’ll mark brainliest . In each of the circles below, four angles are formed by the intersection of two secant lines.
The measures of two intercepted arcs and one angle are shown for the first three circles.

Which equation could be solved to find an expression that represents the measure of qs in
degrees?

Answers

9514 1404 393

Answer:

  B

Step-by-step explanation:

The angle where the chords cross is half the sum of the intercepted arcs. The expression below says that. It is the 2nd choice.

These triangles
are congruent
by the triangle
congruence
postulate [? ].
A. SAS

Answers

Answer:

SAS

Step-by-step explanation:

ITS CORRECT CUZ SAME ANGLE, AND TWO OF THE SAME SIDES

(2/5)p=14

Mike sold y boxes of cookies for $5 each. He made at least $200.
What’s the least amount of boxes of cookies he sold?

Answers

Answer: 1 =5$

200$=40

Step-by-step explanation:

Answer:

40 boxes

Step-by-step explanation:

200 = 5x

x = 40

-3(4x + 3) +4(6x + 1)= 43
Step by step solution
Need help ASAP PLEASE!!

Answers

Answer:

x=4

Step-by-step explanation:

-3(4x+3)

you need to break open the paranthesis

-3 times 4x equals to -12x. -3 times 3 equals to -9. That means that this expression is equal to -12x-9.

4(6x+1)

you need to break open the paranthesis

4 times 6x equals to 24x. 4 times 1 equals to 4. That means that this expression is equal to 24x+4.

-12x-9+24x+4=43

move all variables to the left side and numbers to the right side

-12x+24x=43-4+9

12x=48

x=4

If your Uncle Jack was on his roof, and he wanted you to help him down, would you help your Uncle Jack off?

Answers

Yes I would help uncle Jack off the roof
yes i would help him off? you wouldn’t want someone to stay on a roof all day...

Brainliest if its correct :)

Answers

Uhh i don’t know for sure but would it be 10.33?

I mark brainliest 5+5

Answers

Answer:

5+5 is 10 lol but thanks I guess

Help Please!!!
Thanks

Answers

it’s a!! you can check by replacing x with the numbers inside the brackets until the equality is true!

Answer:

d i hope please be d please please

You and 3 friends meet at Magnolia Bakery. Your bill is $76.20 & you leave a 15% tip. What is the total bill?

Answers

Answer:

$87.63

Step-by-step explanation:

Given data

Your bill=  $76.20

Tip= 15%

Let us find the amount of 15% tip

=15/100*76.20

=0.15*76.20

=$11.43

Hence, the total bill is

=11.43+76.20

=$87.63

URGENT! pls help and give a explanation. if you do i’ll mark brainliest !!

Answers

Answer:

i think ur right but i dont know for sure i did the math and got that

Step-by-step explanation:

NEED HELP ASAP BRAINLIEST TO THE FASTEST.
Yolanda has two grandfather clocks in her home. One must be wound every six days. Other must be wound every 14 days. Yolanda winds up both clocks on December 15. When is the next time she will have to wind both of the clocks on the same day?

Answers

Answer:

January 26 or in 42 days

Step-by-step explanation:

The smallest amount of days that both grandfather clocks share is 42 days. 42 days from December 15 is January 26.

hope this helps :)

I have $460 less than dotun. Altogether we have $1280. How much do we have

Answers

Answer:

you have $180, total there is $1280

Step-by-step explanation:

The required amount we have is given as $410, as of the given condition.

What are equation models?

The equation model is defined as the model of the given situation in the form of an equation using variables and constants.

here,
Let the amount we and Dotun has to be x and y,
According to the question,
x  = y - 460- - -- - -(1)

x + y = 1280 - - - (2)
From equation 1
y - 460 + y = 1280
2y = 1280 + 460
y = 1740/2
y = $870

Now,
x = 870 - 460
x = $410

Thus, the required amount we have is given as $410, as of the given condition.

Learn more about models here:
https://brainly.com/question/22591166
#SPJ5

express T¹ in terms of S¹ 3+7+11+15+19+23+27​

Answers

You should get 105 if I’m certainly correct

Write the quadratic equation whose roots are 6 and 2, and whose leading coefficient is 2

Answers

Answer:

Step-by-step explanation:

y = 2(x-6)(x-2) = 2(x²-8x+12) = 2x² - 16x + 24

PLEASE HELP. I NEED ALL!!!!

y=6x if x = 1

y=6x if x = 2

y=6x if x = 3

y=6x if x = 4

y=.5x if x = 1

y=.5x if x = 2

y=.5x if x = 3

y=.5x if x = 4

y=-0.2x if x = 0

y=-0.2x if x = 1

y=-0.2x if x = 2

y=-0.2x if x = 3

Answers

1. y= 6
2. y= 12
3. y=18
4. y= 24
5. y=5
6. y= 10
7. y=15
8. y= 20
9. y=0
10. y= 0.2
11. y=0.4
12. y=0.6

Hope this helps!
I think it is 0.6 but I’m not sure

In a cafeteria, 1/6 of the students are eating salads , and 2/3 are eating sandwiches. There are 12 students in the cafeteria. How many students are eating lunches other than salads or sandwiches?

Answers

Answer:

2 other people

Step-by-step explanation:

Find the measure of arc JMK.

Answers

I agree with the person on top have a wonderful day:)

Some help pls shhsnsshnasnnansnsnsnsnsnsnsnsnsnsnsnsnnsnsnsnsndndndndndndnnrnrnrnrnfn

Answers

Answer:

Step-by-step explanation:

B

the answer is A i wish that helped :)



Matthew has two kinds of rice shown in this table.
Rice
Brown:Amount (cups)
8 7/8
White: 6 3/4

How much more brown rice than white rice does Matthew have?
cups

ANSWER PLS
I will make Brainlyest

Answers

He has 2 1/8 cups more brown rice than white rice

Please answer this correctly without making mistakes I want ace expert and genius people to answer this correctly without making mistakes

Answers

Answer:

yz + z = -22

Step-by-step explanation:

Ok so you are already the number that y = 10 and z = -2. You will plug these number in the equation in order to find the answer. :-

y = 10 and z = -2

yz + z

10(-2) - 2

-20 - 2

-22

Hope this helps, thank you :) !!

Five adult tickets and three child tickets for a movie cost £58.
Two adult tickets and eight child tickets for a movie cost £47.
Find the cost of each type of ticket.

Answers

Answer:

Step-by-step explanation:

Answer:

so for the first one the cost for all the tickets is 412

for the last one the cost is 333

Step-by-step explanation:

pls help me im sooo stuck on math​

Answers

87

You can add up the angles that are labeled(73,110,and 90 because of the right angle) and get 273.

For a quadrilateral, all of the angles add up to 360.

So, subtract 360-273.

You get 87.

Hope this helps:)

This pyramid has a square base.
The length of each side of the square is 11 cm.
Each triangular face has an area of 62 cm2.
What is the total surface area of the pyramid?
11 cm

Answer:

Answers

The total area of the pyramid is the area of the square plus the area of the four triangles which is 62+62+62+62+(11*11)=369 cm2

Question 4 of 10
In each family of functions, the
the family
function is the most basic function in
O A simple
O 8. parent
O c. quadratic
O D linear

Answers

Answer:

In each family functions, the parent function is the most basic function in the family.

In each family of functions, the parent function is the most basic function

How to complete the blank?

A linear function is represented as:

y = mx + b

A quadratic function is represented as:

y = ax^2 + bx + c

The above and others of similar formats are the most basic of their families, and they are referred to as the parent function

Read more about parent function at:

https://brainly.com/question/17079244

#SPJ6

Need help with math homework

Answers

The radius for the first question is approximately 23.5

Solve this system of equations:
y = x - 4
y = 6x - 9
Show your work in the text box below.
also Write your answer as an ordered pair.

Answers

Answer:

y=-3 x=1 (1,-3)

Step-by-step explanation:

y=x-4

y=6x-9

y+4=x

y+9=6x

difference = 5

x+5=6x

x=1

y=-3

1,-3

What is the right answer

Answers

Answer:

Earth, Sun, Sun, Earth

Step-by-step explanation:

earth, sun , sun earth

Aubrey was buying candy for goodie bags for her birthday party. She bought 6 pounds of Jelly beans. How much did she spend on Jelly Beans? (please don´t guess)

Answers

Answer:

$8.35

Step-by-step explanation:

6 pounds is $8.35

Help fast help fast help Help fast help fast help Help fast help fast help Help fast help fast help Help fast help fast help Help fast help fast help Help fast help fast help Help fast help fast help Help fast help fast help Help fast help fast help

Answers

Answer:

The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one The last one :)

Step-by-step explanation:

A new pair of sneakers is on sale for $99. They were 10% off the original price. What was the original price?

Answers

Answer: $110


Explanation: 110 x .1 = 11
110 - 11 = 99
Other Questions
how long will it take for a car at rest to accelerate at 7m/s^2 to a speed of 45 m/s What is the distance between (3, -2), (2, -4)? Brad found Middle C on the piano writerA) any note he wanted it to beB) to the left of the three black notes at the bottomC) to the left of the 2 black notes in the middleD) to the right of the 2 black notes in the middle Determine which equation has the same solutions as the given equation.x2 10x 11 = 0A. (x 10)2 = 36B. (x 5)2 = 36C. (x 5)2 = 21D. (x 10)2 = 21 if you subtract 17 from my number and multiply the difference by -6 the results is -138 what is Sarah's number Find the volume for the regular pyramid.6 cu. units12 cu. units4 cu. units What role does Janes ambiguous social position play in determining the conflict of her story? (its based on the book Jane eyre)I need this ASAP! DQuestion 2If a right triangle has side lengths 6, 6.7 and 3, which side is the hypotenuse?O 3O 6.7O 15.706 What characteristics do Percy and his mother have in common? How do they differ? Plz help me!Plz well mark brainliest if correct! distace x time graph will be ................ if the body is in ununiform motion Was there a contradiction between Balfours proposal to establish a national home for the Jewish people and the promise that nothing shall be done which may prejudice the civil and religious rights of existing non-Jewish communities in Palestine? If so, why did he make two contradictory promises? argumentative essay on genetically modified foodsCAN SOMEBODY HELP ME WITH DIS PLZZ DONT PUT ANYTHANG SLOW PLZZ help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: