Plzzz help 5 min leftttt​

Plzzz Help 5 Min Leftttt

Answers

Answer 1

Answer:

Time for learning?

Answer is A i think


Related Questions


In the figure shown, BC is parallel to
AD and AB =
AB = CD. What is the
perimeter of quadrilateral ABCD ?

Answers

Answer:

52 units.

Step-by-step explanation:

If we drop a perpendicular line from point C to AD and call the point ( on AD) E we have a right triangle CED.

Now CE = 6 and as the whole figure is symmetrical about the dashed line,

ED = (26 - 10)/2

= 8.

So by Pythagoras:

CD^2 = 6^2 + 8^2 = 100

CD = 10.

So, as AB = CD,

the perimeter = 10 + 26 + 2(8)

= 52.

The perimeter of the Quadrilateral ABCD is 56

Given that :

BC = 10

AD = 26

AM = ND = (26 - 10) / 2 = 16 / 2 = 8

Using Pythagoras:

AB² = AM² + BM²

AB² = 8² + 6²

AB² = 64 + 36

AB² = 100

AB = √100

AB = 10

AB = CD = 10

THE PERIMETER OF THE QUADRILATERAL WILL BE :

AB + BC + CD + AD

10 + 10 + 26 + 10 = 56

HENCE, The PERIMETER of the quadrilateral ABCD = 56

Learn more on perimeter if quadrilaterals : https://brainly.com/question/17021591

16. A triangle has side lengths of 6, 8, and 10. Is it a right triangle? Explain.

Answers

Answer

well no

Step-by-step explanation:

Determine the approximate average rate of change in the number of tickets sold between the 3rd and 10th days after the release.
OA.
OB.
The number of tickets sold changed at an average rate of approximately -20 tickets per day.
The number of tickets sold changed at an average rate of approximately – 7 tickets per day.
The number of tickets sold changed at an average rate of approximately –10 tickets per day.
The number of tickets sold changed at an average rate of approximately –3 tickets per day.
Ос.
D.

Answers

Answer:

-3 Is the average rate

Step-by-step explanation:

The number of tickets sold changed at an average rate of approximately -20 tickets per day. The correct answer is option A.

What is the average rate of change?

The average rate of change is the average amount by which the function changed per unit throughout that time period. It is calculated using the slope of the line linking the interval's ends on the graph of the function.

The rate of change is calculated by the formula below:-

Rate of change = Final value - initial value.

From the given graph the value of tickets on the 3rd day is 100 and on the 10th day is 80. The final value of tickets is 80 and the initial value is 100.

The average rate of change in the number of tickets sold between the 3rd and 10th days after the release will be calculated as below:-

Rate of change = Final value - initial value.

Rate of change = 80  - 100

Rate of change = -20

Therefore, the number of tickets sold changed at an average rate of approximately -20 tickets per day. The correct answer is option A.

To know more about the average rate of change follow

https://brainly.com/question/8728504

#SPJ2


A father is 28 years older than his daughter. In six years' time, he will be three times her age. Find their present ages.


Please include your working out!!

Answers

Answer:

Daughter's age = 6Father's age = 34

Step-by-step explanation:

Let the age of daughter be x

Then the age of father will be x + 28

In 6 years time:-

The age of father = x + 28 + 2 = 30 + x

The age of daughter = x + 6

According to the question,

Father will be three times the age of his daughter.

30 + x = 3(x + 6)

30 + x = 3x + 18

x - 3x = 18 - 30

-2x = - 12

x = - 12/-2

x = 6

So therfore,

Daughter's present age = 6 years

Father's present age = 34 years

Hope this helps :)


A father is 28 years older than his daughter. In six years' time, he will be three times her age. Find their present ages.


Please include your working out!!

Juliet has y quarters, 6 dimes, and 4 nickels. the total amount of money that juliet has is $3.30. how many quarters does juliet have?

Answers

Juliet has 10 quarters

What 2 numbers have a sum of 19 and difference of 9

Answers

Step-by-step explanation:

The two numbers having a sum of 19 and difference of 9 is

14 and 5

14 + 5 = 19

14 - 5 = 9

Hope it will help :)

Answer:

14 and 5

Step-by-step explanation:

-#--#--2-#--$--#6*363282873737282

Brice has $1200 in the bank. He wants to save a total of $3000 by depositing $40 per week from his paycheck. Write and use an equation to find how many weeks he needs to reach his goal.

Answers

$$3000-$1200=$1800

take $1800÷$40=45

answ=45 weeks

Pls help asap I have 10 min left to answer :(

Answers

Answer:

A. 1 foot

Step-by-step explanation:

Answer:

your answer will be A.1 foot

Step-by-step explanation:

hope it helps you

have a great day

find f(4) if f(x) = x - 6​

Answers

you would plug in 4 for x.
f(4)= (4) - 6 = -2

Find the equation of the line.
Use exact numbers
y=*blank*x+*blank*

Answers

Y=1/2x—3
Hope that helps
Y = 1/2x + -3 !!!!!!!

4,179 mL = ____ L ____ mL how many is liters
how many is mL
And how do I show my work for this?

correct=brainliest

Answers

1L = 1000 ML

So if there is 4,179 ML in whatever it’s on you have 4.1 L. Here is your answer

4179 ML 4 L 179 ML
——— —————

A 20ft ladder is leaning against a building. If the base of the ladder is 6ft from the base of the building. What is the angle of elevation of the ladder?

Answers

9514 1404 393

Answer:

  72.5° ≈ 73°

Step-by-step explanation:

The ladder length is the hypotenuse of the right triangle that has the distance from the building as its base and the height up the building as the height of the triangle. The given dimensions are those of the side adjacent to the angle and the hypotenuse.

The appropriate trig relation is ...

  Cos = Adjacent/Hypotenuse

  cos(angle) = 6/20

The inverse cosine function (arccos) is used to find the angle from its cosine.

  angle = arccos(6/20) ≈ 72.54°

The angle is 72.5° rounded to tenths, or 73° rounded to degrees.

HELPPP ME PLEASE WOTH THIS PROBLEM

Answers

Answer:

Area = 220.8 units²

Step-by-step explanation:

Since, given regular hexagon is made up of 6 congruent triangles joined together.

Area of the given regular hexagon = 6(Area of ΔAOB)

Area of ΔAOB = [tex]\frac{1}{2}(\text{Base})(\text{Height})[/tex]

                        = [tex]\frac{1}{2}(AB)(OC)[/tex]

                        = [tex]\frac{1}{2}(9.2)(8)[/tex]

                        = 36.8 unit²

Therefore, area of regular hexagon = 6(36.8)

                                                 = 220.8 units²

Please answer the two questions!

Answers

Given:

The expressions are

(c) [tex]\left\{\left(\dfrac{2^4\times 3^6}{12^2}\right)^0\right\}^3[/tex]

(d) [tex]\dfrac{13^3\times 7^0}{\{(65\times 49)^2\}^1}[/tex]

To find:

The simplified form of the given expression.

Solution:

(c)

We have,

[tex]\left\{\left(\dfrac{2^4\times 3^6}{12^2}\right)^0\right\}^3[/tex]

We know that, zero to the power of a non-zero number is always 1. So, [tex]\left(\dfrac{2^4\times 3^6}{12^2}\right)^0=1[/tex]

[tex]\left\{\left(\dfrac{2^4\times 3^6}{12^2}\right)^0\right\}^3=(1)^3[/tex]

[tex]\left\{\left(\dfrac{2^4\times 3^6}{12^2}\right)^0\right\}^3=1[/tex]

Therefore, the value of the given expression is 1.

(d)

We have,

[tex]\dfrac{13^3\times 7^0}{\{(65\times 49)^2\}^1}[/tex]

It can be written as

[tex]\dfrac{13^3\times 7^0}{\{(65\times 49)^2\}^1}=\dfrac{13^3\times 1}{(65\times 49)^2}[/tex]

[tex]\dfrac{13^3\times 7^0}{\{(65\times 49)^2\}^1}=\dfrac{13\times 13\times 13}{(65\times 49)(65\times 49)}[/tex]

[tex]\dfrac{13^3\times 7^0}{\{(65\times 49)^2\}^1}=\dfrac{13}{(5\times 49)(5\times 49)}[/tex]

[tex]\dfrac{13^3\times 7^0}{\{(65\times 49)^2\}^1}=\dfrac{13}{60025}[/tex]

[tex]\dfrac{13^3\times 7^0}{\{(65\times 49)^2\}^1}=\dfrac{13}{60025}[/tex]

Therefore, the value of given expression is [tex]\dfrac{13}{60025}[/tex].


Charmaine is fertilizing her garden. The garden is in the shape of a rectangle. Its length is 12 feet and its width is 10 feet. Suppose each bag of fertilizer covers
30 square feet. How many bags will she need to cover the garden?

Answers

Answer:

4 bags

Step-by-step explanation:

lxw

12x10=120

30x4=120

l=length

w=width

If the volume of the cone is 250 feet, what is the missing length?
Use 3.14 for it and round the answer to the nearest hundredth.
1
1
h=?
r=6 feet
feet.
The missing length is

Answers

Answer:

6.63

Step-by-step explanation:

can anyone help this is due todaaaaaaay

Answers

Answer:

A. 15

Step-by-step explanation:

Use 1/3 multiply length times width times height then divide

Suppose a normal distribution has a mean of 266 and a standard deviation of
12. What is P(x>278)?

Answers

Answer:

I think the answer is P(x>178)

Step-by-step explanation:

Answer: 0.16

Step-by-step explanation: Quizzed

Suppose you deposit 600​$ in a bank account with a simple interest rate of ​2.5%. You want to keep your deposit in the bank long enough to earn at least ​120$ in interest. How long should you keep your deposit in the​ bank?

Answers

We’ll use I = PRT where I is the interest earned, P is the principal/money invested, R is the interest rate converted to a decimal, and T is time in years.

In this case, T is the variable we don’t have a value for.

120 = (600)(0.025)(T)
120 = 15T
8 = T
8 years

Investors buy a studio apartment for $240,000. Of this amount, they have a down payment of
$48,000. Their down payment is what percent of the purchase price? What percent of the purchase
price would a $12,000 down payment be?
Their down payment is
% of the purchase price.

Answers

Answer:

Part A

The down payment of $48,000 is 20% of the purchase price

Part B

A $12,000 down payment will be 5% of the purchase price

Step-by-step explanation:

A percentage is the expression of the product of the ratio of two numbers and 100

The amount the investors buy the studio apartment = $240,000

The amount the investors have as down payment = $48,000

Part A

The ratio of the down payment the investors have and the amount the investors buy the apartment = 45,000/240,00 = 0.2

Therefore, their down payment is 0.2×100 = 20% percentage of their purchase price

Their $48,000 down payment is 20% of their purchase price

Part B

The percentage of the purchase price a $12,000 down payment would be is given as follows;

12,000/240,000 × 100 = 5%

Therefore, a $12,000 down payment will be 5% of the purchase price.

Please answer I will give BRAINLIEST if i can

Answers

Answer:

Glass A holds the most, It holds more than glass B because of its cone shape.

Step-by-step explanation:

I hope I helped you, now have a good day and good luck!! ;)

A toy made of connecting blocks is in the shape below. Find its total volume. 4 yd 3 yd 2 yd 4 yd 8 yd 9 yd Figure not drawn to scale. A 24 yd B 288 yd 312 yd D 325 yd​

Answers

In order to find this, you have to find both the top and the bottom volumes and add them together. To find the bottom volume you’d use the formula lwh or Length*width*height. First you’d substitute in the numbers for the formula and get 9yd*8yd*4yd and get 288yd cubed. Then to find the top one you use the same formula and use 4yd*3yd*2yd and get 24yd cubed. Finally you add the two volumes together and get 288yd cubed + 24yd cubed=312yd cubed

I NEED HELPPPPPP PLSSS !!!!

Answers

Answer:

If they scored 8 touch downs then the answer would be 48 points.

Explanation: 8x6=48

3. What is the greatest common factor (GCF) of: *
48x2 and 32x3

Answers

Answer:

96

Step-by-step explanation:

48*2=96

32*3=96

GCF=96

The required greatest common factor for the values 48x² and 32x³ is 96x³.

Given that,
To determine the greatest common factor (GCF) of 48x² and 32x³.

What is the greatest common factor?

The greatest common factor is defined as a group of the set of numbers that is the most considerable and greatest factor that all the numbers include of.

Here,
Factors of 48x² and 32x³,
= 48x², 32x³ = 2⁵ * 3 * x³
= 96x³

Thus, the required greatest common factor for the values 48x² and 32x³ is 96x³.

Learn more about grates common factors here: https://brainly.com/question/11221202
#SPJ5

Mhanifa can you please help me with this? I will mark brainliest

Answers

Answer:

Let's assume we have a line segment AB and constructed a perpendicular bisector of this line segment.

Every point of the perpendicular bisector will be equidistant from both point A and point B.

To construct the isosceles triangle, we need to chose a point on the perpendicular bisector, name it C and draw line segments from C to point A and to point B.

We will get an isosceles triangle ABC.

please help me find the value of x

Answers

Answer:

[tex]10 \sqrt{3} [/tex]

Step-by-step explanation:

Given Question,

To find the value of x.

Solution:

According to Pythagoras Theorem-

[tex] {20}^{2} = {10}^{2} + {x}^{2} [/tex]

[tex] = > 100 + {x}^{2} = 400[/tex]

[tex] = > {x}^{2} = 400 - 100[/tex]

[tex] = > {x}^{2} = 300[/tex]

[tex] = > x = \sqrt{300} [/tex]

[tex] = > x = 10 \sqrt{3} [/tex]

Result:

Hence, the required value of x is

[tex] 10\sqrt{3} [/tex]

Solve to find the value of x.

Answers

Answer:

x=12

Step-by-step explanation:

We know that a right angle is 90 degrees. So we can make the equation [tex]35+4x+7=90.[/tex] Now, we can solve fore X! We can combine 35 and 7 to make the equation [tex]4x+42=90[/tex]. In order to isolate x we have to subtract 42 from both sides, getting us the equation [tex]4x=48.[/tex] Now, in order to isolate x we must divide each side by 4, getting us the equation [tex]12=x[/tex].  To prove that x=12, we can subsitute x for 12.  This means that we can do [tex]35+4(12)+7=90. Or, 35+48+7 =90,[/tex] which simplified, is 90=90, making x=12 true. Hope this helps :)

quadrilateral vwxy with vertices v(-2,-1) w(-5,-2) x(-8,-7) and y(1,-6): 18o from the origin

Answers

Given:

The vertices of a quadrilateral are v(-2,-1) w(-5,-2) x(-8,-7) and y(1,-6).

To find:

The vertices of the image of quadrilateral vwxy after 180° about the origin.

Solution:

If a figure rotated 180° about the origin, then the rule of rotation is

[tex](x,y)\to (-x,-y)[/tex]

Using this rule, we get

[tex]v(-2,-1)\to v'(2,1)[/tex]

[tex]w(-5,-2)\to w'(5,2)[/tex]

[tex]x(-8,-7)\to x'(8,7)[/tex]

[tex]y(1,-6)\to y'(-1,6)[/tex]

Therefore, the vertices of image of quadrilateral vwxy after 180° about the origin are  v'(2,1), w'(5,2), x'(8,7), y'(-1,6).

I need help ASAP
questions:
1. what is the measure of angle K?
2. What is the measure of angle M?
3. what is the value of "x"?​

Answers

1) k is 180*-120*=60*
2)M is 180*-40*=140*

PLEASE HELP ME NOW!!!! 100 POINTS!!!
Decorative glass balls are being stored in a box. Each ball has a radius of 2 1/3 cm.

How many balls will fit in each layer of a box that is 20 cm by 15 cm?


7 balls

12 balls

48 balls

Answers

Answer: 12 balls i think

Answer:

answer is 12

Step-by-step explanation:

i took the quiz.

Other Questions
A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks. If 2 cups makes 6 servings, how much makes 2 servings? shawtys been simping for so long.. do you think hunter-gatherers are still around today? what makes you think that? Hi, I am very stuck on questions 17 and 18. Can someone help please? Thanks In which quadrant does the point with c ordinate (4, -3) lie? Which student has the greater median test score? I have to study for a test. It's for data management. Does anyone have tips? (Grade 7) PLEASE HELP ME WITH ALGEBRA! THANK YOU Explain how Japan took control of Manchuria. This is worth 16 points if you show work you will get the Brainliest answer if your unable to show work type it for your explanation plz ( no links )