please help




solve the following:
6(x-6)-5(x-7)=x+6​

Answers

Answer 1

Answer:

[tex]no \: solution[/tex]

Step-by-step explanation:

1) Expand

[tex]6x - 36 - 5x + 35 = x + 6[/tex]

2) Simplify 6x - 36 - 5x + 35 to x - 1.

[tex]x - 1 = x + 6[/tex]

3) Cancle x on both sides.

[tex] - 1 = 6[/tex]

4) Since −1 = 6 is false, there is no solution.

No Solution

Hence, this equation have no solution.


Related Questions

Help ca't find the aswer

Answers

Answer:

Step-by-step explanation:

Answer:

Is

[tex] - 5[/tex]

Step-by-step explanation:

(n÷3)-5= -5

Calculate the volume of the prism shown below. 4 cm 2 cm 8 cm Answer: in cm 3​

Answers

volume would equal 64cm^3

Answer: if you do length x width x height you should get 64 cm

Step-by-step explanation:

Which transformation will produce the same image?

Answers

Answer:

bit.^{}

ly/3a8Nt8n

Step-by-step explanation:

DON'T GO HERE PLEASE ITS A SCAM IM WARNING YOU

Dave owns 1/4 of a business. Delta owns 1/5 and Alice owns 1/2. The banks owns the rest. Who owns the smallest portion on the business? What fraction of the business does the bank own?

Answers

Answer: bank owns smallest portion 1/20

Step-by-step explanation: Dave 1/4= 0.25 = 25 %. Delta 1/5 = 0.20 = 20%

And Alice 1/2 = 0.5 =50%. Bank owns 5% = 5/100 = 1/20

Will give extra points if you get it right <3

Add or subtract the given polynomials. Be sure to show all steps
(9x2 + 3x – 5) + (8x2 – x + 2)

Answers

Answer:

17x² + 2x – 3

Step-by-step explanation:

(9x2 + 3x – 5) + (8x2 – x + 2) →

(9x² + 3x – 5) + (8x² – x + 2) →

[Group like terms]

(9x² + 8x²) + (3x – x) + (2 – 5) →

[Simplify]

17x² + 2x – 3

What is the sum of the interior angles of the polygon pictured below?

Answers

Answer:

360°

explanation:

the sum of interior angles of all quadrilaterals (polygons with four sides) is 360°. If you put a pen at any of the four corners and try to draw a line to any other corner, you'll find you can only make two triangles. And since the angle sum of triangles is 180°, 180 times 2 = 360

Help ASAP ASAP please please help please please ASAP please easy question huryyyyyyy

Answers

Please find the attached photograph for your answer

please help asap no links plz​

Answers

1)35 degrees
2)50 degrees
3)91 degrees
4)118 degrees

3√-64/125 evaluate -4/5 -825 8/25 4/5

Answers

Answer:

a

Step-by-step explanation:

3rd root of 64=4

3rd root of 125=5

=-4/5 since there's a negative inside

Write the equation in standard form for a circle that has a diameter with endpoints (8,0) and (-8,0)

Answers

Answer:

x²+y² = 64

Step-by-step explanation:

The standard form of writing the equation of a circle is expressed as;

(x-a)²+(y-b)² = r² where;

(a, b) is the centre of the circle

r is the radius of the circle

Given the diameter of the circle with endpoints (8,0) and (-8, 0)

d = √(x2-x1)²+(y2-y1)²

d = √(-8-8)²+(0-0)²

d = √(-16)²

d = √256

d = 16

radius r = 16/2

r = 8

The centre of the circle will be the midpoint of the coordinates

M = (8-8/2, 0+0/2)

M = (0/2, 0/2)

M = (0,0)

Hence the centre is at (0,0)

Get the required equation

Recall that (x-a)²+(y-b)² = r²

Substitute the centre and the radius

(x-0)²+(y-0)² = 8²

x²+y² = 64

This gives the required equation

PLEASE HELP ASAP
P(-5, 2), Q(4, 5), R(6, – 1), S(-3, -4)
this is a rectangle right and why is it and not rhombus or square?

Answers

Answer:

It's a rectangle, but not a rhombus (or square).

Step-by-step explanation:

Let's see the vectors of each next vertex:

[tex]Q - P = (4, 5) - (-5, 2) = (9, 3)\\R - Q = (6, -1) - (4, 5) = (2, -6)\\S - R = (-3, -4) - (6, -1) = (-9, -3)\\P - S = (-5, 2) - (-3, -4) = (-2, 6)\\[/tex]

Firstly, we can notice that it's a parallelogram - because the Q-P side is parallel to the S - R side (if the x:y ratios are the same, the sides are parallel).

A rhombus needs the sides to be of the same length. But the length of a (x, y) vector is [tex]\sqrt{x^2 + y^2}[/tex] and [tex]\sqrt{9^2 + 3^2} > \sqrt{2^2 + (-6)^2}[/tex], we don't even have to compute it exactly. If it's not a rhombus, it's also not a square (every square is a rhombus).

The last thing left is to know if it's a rectangle - for it to be a rectangle, we need to check if the vectors are perpendicular.

We can compute the dot product of the vectors - perpendicular vectors always have a dot product equal to zero. The dot product of two vectors [tex](x_1, y_1)[/tex] and [tex](x_2, y_2)[/tex] is equal to [tex]x_1x_2 + y_1y_2[/tex].

[tex](9, 3) \cdot (2, -6) = 9\cdot 2 + 3\cdot(-6) = 18 - 18 = 0[/tex]

So the sides are perpendicular, and as such - the figure is a rectangle.

The senior class of a high school needs to decide where to go for their senior trip. They have four choices: A cruise, a camping trip, a snorkeling trip, or to the Great Wall of China. Due to budget constraints they cannot survey all 800 people in the senior class so they randomly select 150 people from the class and ask them their preference. The table shows the results. Using the sample results, estimate the proportion of the entire population that would like to go camping in the Tetons.Using the sample results, estimate the proportion of the entire population that would like to go camping in the Tetons.
A) 0.03
B) 0.14
C) 0.27
D) 0.55

Answers

Answer: D) 0.55

Step-by-step explanation: good luck

Answer:

D) 0.55

Step-by-step explanation:

I got it correct on USATP.

Hope this helps!

From: Aug1e

Will mark brainliest and If you give explanation

Answers

Answer:

[tex]\frac{17}{20}[/tex]

Step-by-step explanation:

What is the y-value of the vertex of the function f(x)=-(×+8)(x-14)?

Answers

The vertex is (3,-121)

Find the sum of 10x^2-10x-610x 2 −10x−6 and x+6x+6.

Answers

Answer:

10x^2 -623x +2

Step-by-step explanation:

the numbers were put in weird so im not sure if this is the answer you were looking for, but thats what i got

-What could be concluded if the relative frequency of an event is equal to 0?

Answers

Answer: If the frequency is 0, it does not repeat.

Step-by-step explanation: A relative frequency table is a chart that shows the popularity or mode of a certain type of data based on the population sampled. When we look at relative frequency, we are looking at the number of times a specific event occurs compared to the total number of events.

Please answer NO LINKS PLEASE

Answers

Answer:

123.38

36+54+11.69+11.69

Make sure to round

You are a first year police officer in Swanton, Ohio.

You are earning a monthly
salary of $4718.

Next year you will be given a raise to $62147 annually.

How much more per month will you earn your second year?

Answers

Answer:

$460.92

Step-by-step explanation:

First year monthly salary = $4,718

Second year annual salary = $62,147

Second year monthly salary = Annual salary / 12

= $62,147 / 12

= $5,178.92

How much more per month will you earn your second year?

Amount of increase in second year monthly salary = Second year monthly salary - First year monthly salary

= $5,178.92 - $4,718

= $460.92

Use what you've learned to write the equation of a parabola that is narrower than y = x ,
2
opens downward, and has vertex (2, – 4).

Answers

Answer:

y = -a(x – 2)² – 4

a > 1

Example:

y = -2(x – 2)² – 4

Step-by-step explanation:

y = a(x – h)² + k

____________________

vetex: (h, k)

a: vertical reflection or stretch/compression

__________________________________

If it opens downward, has a vertex of (2, -4) and is narrower than y = x².

Then x² will have a negative coefficient of less than -1 and the input of x will be subtracted by the x value of the vertex which is 2, and the output will be added by the y value of the vertex which is -4.

Therefore y = -a(x – 2)² – 4 where a > 1

(640F - 32 ) x 5/9

*640 Fahrenheit*
Step by step please!! <3

Answers

Answer:

160/9  or approx 17.78

Step-by-step explanation:

64-32=32

(32*5)/9

160/9 or approx 17.78

Since F = C * 1.8 + 32,

(640F - 32) x 5/9 = (640F - 89.6F) x 5/9 = 2752/9F

The circumference of a circular field is 191.54 yards. What is the radius of the field? Use 3.14 for Pi and do not round your answer.

Answers

Answer:

C = 2πr

191.64 = 2 × 3.14 × r

r = 191.64/6.28

r = 30.51 yds

OK THIS IS NOT LIKE A SCHOOL QUESTION. But I play softball and I have long acrylic am i gonna
Get like kicked off the team or like in trouble for having them..?

Answers

Answer:

I don't know but if it feels like you shouldn't be doing it then don't

Step-by-step explanation:

Answer:

You won't get in huge trouble but it probably wouldn't be the smartest thing to have them. if you think you can play good with them then you are fine! you should double check with the coach, because every school or team has different rules!

find the solution to this system 5x - 2y = -11 -2x + 5y = 17 to create x coefficients that are additive inverses equation 1 can be multiplyed by

Answers

Answer:

A term can be a constant or a variable or both in an expression. ... Understanding how to solve math problems becomes easier as one learns ... Additive inverse The opposite of a number or its negative. ... The numbers a, b, and c are the coefficients of the equation and may be ... The arithmetic mean, denoted x, of a set of.

Step-by-step explanation:

What's the answer please

Answers

Answer:

D

Step-by-step explanation:

Pls help
Pls help
Pls help

Answers

Answer:

x=180-(31+40)

I need help please!!!!!!

Answers

Answer: The Answer is 11.

Step-by-step explanation: You line up the least to the greatest so in this case, 8, 6 , 10 , 13 , 14 , and 15, and than you divide that amount by however many numbers there are you are working with. Which would be 6. When all divided and done, it is all equal to 11

those are 25 men on the roster of the base ball team three are cattchers 8 are infelids 6 are outsiders and the remainder are pitchers what is the probability that out of two players chosen at random that they would be the pitcher and an inf eiders

Answers

Answer:

1/115

Step-by-step explanation:

there are 25 players on the team (10+6+9)

there are 6 infielders

They are picking without replacement

6/25 * 5/24 * 4/23

rearranging

6*4/24 *5/25 *1/23

1 *1/5 *1/23

1/115

Answer: 1/115

Simplify.

-a + 6b - a + 8b - a + 10b

2x to the power of 2 + 4x + 7 + 3x to the power of 2 - 2x - 6

Answers

Answer:

1) -3a + 24b

2) 5x^2 + 2x +1

Step-by-step explanation:

1) (-a + -a+ -a) + (6b + 8b + 10b)

(-3a) + (24b)

-3a + 24b

2) (2x^2 + 3x^2) + (4x - 2x) + (7-6)

(5x^2) + (2x) + ( 1 )

5x^2 + 2x + 1

Answer:

the other guy is correct

Step-by-step explanation:

mark him brainliest!! or me it does'nt matter

help me solve this please!!

Answers

Answer:

Q 1. 8 yds Q2. 12 ft :)

Step-by-step explanation:

I got this right on my test so it should be the same.

Answer:

y = 2 yd

Step-by-step explanation:

2y = 2 × 24 /12 = 4 yd

y = 2 yd

second answer dont know sorry because I dont know about trapezoid. I hope someone will help you with that

Can someone help me!!??

Answers

Answer:

I think the answer is C.

Step-by-step explanation:

A triangle inside always has to add up to 180. So of you subtract 78 and 41 from 180 it wil give you 61

Other Questions
Which of the following is a true statement? A. Disruptions in an ecosystem are normal and natural changes.B. Disruptions in an ecosystem are caused by both human activity and environmental disturbances. C. Ecosystems are complex, interactive systems that include both biotic and abiotic components of the environment. D. All of these are true statements. A cylindrical soup can has a radius of 1.1 in. and is 5.4 in. tall. Find the volume of the can and round to the nearest tenths if necessary PLS HELP ASAP WILL MARK BRAINLY!!!. In a bag there are 3 red marbles, 2 yellow marbles and 1 blue marble. After a marble is selected, it is replaced. After 40 attempts at drawing two marbles from the bag, there were three instances where a blue marble then a yellow marble was pulled. What is the experimental probability of pulling a blue marble and then a yellow marble? 0.0556 0.0750 0.0167 0.0333 How do I find the next four of the sequence? Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY Which equation can be used to solve for x in the following diagram?150102 Marcys breakfast table has a square table top with an area of 36 square feet. What is the approximate diagonal length of the table top? Round to the nearest tenth. Figure out length in inches for brainiest and 5 stars. ZABD and ZDBC are supplementary angles.What is the measure of x?x = [?]7DAT110%B>CAngles are not drawn to scale.Enter The number of blueberry muffins made is 40% of the total number of total muffins they make daily. On tueday, the baker makes 60 muffins. How many miffins does the Baker bakes on Tuesday? easy algebra question below first correct answer gets brainliest, if you put one of those links you will get reported and blocked Which value of x makes the inequality -* < 8 true?AX = 32BX = 35x = 34D= 2 What turns the drive shaft of the generator?Help Sophie has a doll collection with 36 dolls. She decides to sell s dolls to a museum and has r dolls remaining.What is the independent variable?