please help me with my science will give brainlest help asap 2 question, please dont answer just for points :(

Please Help Me With My Science Will Give Brainlest Help Asap 2 Question, Please Dont Answer Just For

Answers

Answer 1

Answer:

1. 50cm

2. Direct

Explanation:

1. The distance pulled back means you get your answer from the distance pulled back data. Since 50cm is the largest of your given data, that makes the cart go farthest.

2. The farther you pull the band back, the farther the cart will go. Since both increase when you increase the distance you pull the band back, this is a direct relationship.


Related Questions

A cloud of dust and gas in space were stars are formed is a _____ .

Answers

Answer:

nebula

Explanation:

Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?

Answers

Answer:

i dont know i need points

Explanation:

please answer this question asap!!!!

Answers

Answer:

The 2ND one and the 4th one I'm pretty sure

how does pollution travel from a river to the ocean?

a) pollution flows upstream toward the ocean

b) pollution flows downstream toward the ocean

c) pollution flows toward the bank of a river and then to the ocean

d) pollution flows toward the source of a river

Answers

Answer:

d

Explanation:

I would say d, because the other guy said d

16.2.2 Why is it important to complete a course of antibiotics?

Answers

It's because taking them regularly until the prescription is complete helps ensure that all of the illness-causing bacteria are killed or prevented from multiplying

In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine

Answers

Answer:

31%

Explanation:

Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If

G = 19% then C= 19%

19% + 19% = 38%

100% - 38% = 62%

62% for A and T

Divide by 2 and you get

31%

Write a scientific explanation as to “What is the main cause of global warming?"

Answers

Answer:

It is the aspect of climate change

Explanation:

Referring to the long term rise of planet's temperatures,it is caused by increased concentrations of greenhouse gases in atmosphere

Answer:

Excess C02 in the atmosphere caused by coal burning, exhaust, factory smokestacks, and deforestation.

Explanation: i am sorry if this is wrong

PLZZZ HELP MEEEE!!!

The horse latitudes are areas of calm bordered on either side by the prevailing westerlies and what other wind belts?

A. jet streams

B. polar easterlies

C. trade winds

D. doldrums

Answers

Answer:

es la c. trade winds o es la A. jet streams

Describe one method to reduce the air pollutants released from a coal burning power plant

Answers

Answer:

A method to reduce the air pollutants released from a coal burning power plant is carbon capture.

Explanation:

Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.

Body systems interact with one another to carry out life processes. Movement is an important function in animals. Which body
systems work with the skeletal system to enable voluntary movement of the organism? Choose ALL that apply.
A)
nervous system
B)
muscular system
C)
endocrine system
D)
lymphatic system
E)
circulatory system

Answers

A because the nervous system si the guy who helps ur body

Answer:

B

Explanation:

Because it's the muscle helps the body system with the skeletal system to enable voluntary movement of the organism

Someone’s help me please

Answers

Answer:

trailmix

Explanation:

Which of these is NOT true about vaccines?
a. they simulate a specific immune response
b. they cause memory cells to be produced
c. they contain an antigen of a weakened pathogen
d. it has been proven that there are many possible negative side-effects to being vaccinated

Answers

Answer:

I'm going to say A

Explanation:

because it just make more sense

12 POINTS!!

Semiconductors are materials that conduct electric current better than insulators but not as well as conductors.


Please select the best answer from the choices provided

T
F

Answers

Answer:

True

Explanation:

Hope this helps!

Answer:

True :)

Explanation:

If the carrot population increased, the rabbit population would:
NO LINK ANSWERS
A. increase
B. decrease
C. remain the same

Answers

Answer:

The rabbit population would remain the same as the increase in number of carrots doesn't determine / effect the population of rabbits.

Hope my answer helps !

Answer:

i believe the answer is c) remain the same

Explanation:

i say this because food availability wouldn't necessarily cause the population to grow (there would need to be an environmental change for this to happen.)

and the population wouldn't decrease because there would be an abundance of food and since starvation is one of the main causes of population decrease (along with over-crowding.)

good luck :)

i hope this helps

**please let me know if this was incorrect**

have a nice day!

PLEASE HELP!!! I'll mark the first correct answer brainliest!!! 9. A gene has the base sequence that starts with: TAG CAT GGC AT
a) What would be the mRNA base sequence formed during transcription, using the DNA sequence shown above? (3 points)
b) What would be the first three amino acids in the protein formed from this gene? (3 points)
c) The gene has a mutation and is changed to the sequence below.
TAG CTT GGC AT
What kind of mutation is this? (2 points)
d) What is the new mRNA strand formed by this gene? (3 points)
e) What are the new amino acids formed from this gene? (3 points)
f) Describe how the mutation has affected the protein coded by this gene. (3 points)

Answers

The mRNA base sequence formed during transcription, using the DNA sequence TAG CAT GGC AT would be: AUC GUA CCG UAG. The first three amino acids in the protein formed from this gene would be: Isoleucine, Valine, and Proline. The new mRNA strand formed by this gene due to the mutation would be: AUC GUU GCC UAU

What are the new amino acids formed from this gene?

The new amino acids formed from this gene due to the mutation would be: Isoleucine, Leucine, and Cysteine (since the codons for these amino acids are AUG, CUU, and UGU respectively).

Describe how the mutation has affected the protein coded by this gene.

The mutation has affected the protein coded by this gene by changing the second amino acid from valine to leucine. Depending on the specific protein, this could potentially impact its function and structure, which could affect the organism's phenotype.

To learn more about phenotype, visit here:

https://brainly.com/question/28474179

#SPJ1

Carbon, hydrogen, and oxygen from sugar molecules may combine with other elements to form other biomolecules. The picture
above shows an example of this. Examine the model and choose ALL of the statements that accurately describe the formation of the
new biomolecule.
A)
Proteins are being formed.
B)
The monomers are amino acids.
o
This is a hydrolysis reaction.
D)
Carbohydrates are being broken down.
E)
This is a dehydration synthesis reaction

Answers

B- the monomers are amino acids had the answer key last year

The following statements are true from the image;

Proteins are being formed.The monomer, are amino acids.

Many biomolecules are naturally occurring polymer substances. In this case the biomolecule that is being formed is a protein.

A protein is composed of several peptide bonds formed from amino acids. Hence, the monomer in this case are amino acids from which polypetides and proteins are formed.

Learn more: https://brainly.com/question/1443134

I mark Branliest for the correct answer quickly please listen to me Eyes Blue

Answers

Answer:

1(i think)

Explanation:

The nucleus controls and regulates the activities of the cell (e.g., growth and metabolism) and carries the genes, structures that contain the hereditary information. Nucleoli are small bodies often seen within the nucleus. The gel-like matrix in which the nuclear components are suspended is the nucleoplasm.

Which of the following is an example of a producer-consumer
relationship?
productor?
Worm --> Bird
Leaf --> Tree
Fish --> Bear
Grass --> Deer

Answers

Answer:

Grass and Deer

Because Grass is consumer and Deer is producer

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

How is energy produced by respiration stored

Answers

Answer:

Explanation:

Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.

Answered by the ONE & Only #QUEEN aka  #DRIPPQUEENMO

Hope this helped!!!

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

In rabbits, the gene for black fur is dominant over the gene for white fur. How can the appearance of white baby rabbits be explained when the mother has white fur, and the father has black fur?

Answers

Answer:

it is going to xx or xy those genes of the father and the father

What processes can increase the amount of atmospheric CO2?

Answers

Answer:

Explanation:

Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt.

Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.

Answered by the One & ONLY #QUEEN aka #DRIPPQUEENMO

Hope This Helped !! :)

Human-induced emissions from fossil fuels contribute a relatively small amount of the increase in atmospheric CO2Deforestation and forest degradation reduces the removal component of this cycle, further increasing the carbon dioxide in the atmosphere

what is an indication that water is entering a cell?

Answers

Answer:

water decreasing from where it came from

Explanation:

that or the cell starts to swell

What occurs when someone exhales? A. The rib cage contracts, but the diaphragm relaxes. B. Both the rib cage and the diaphragm relax C. Both the rib cage and the diaphragm contract. D. The rib cage relaxes, but the diaphragm contracts

Answers

Answer:

Answer is A ............

Edit: its actually D... i just verified

Answer:

The answer be D if you doubt you can try out the practical yourself.

Someone plz help me! ☺️

Answers

i think its amino acid

Why might scientists be interested in using algae for biofuel production?

Answers

Answer:

Algae actively absorb carbon dioxide, and therefore reduce the greenhouse effect. Fuel from microalgae is called third-generation biofuel, and development for its production is currently underway. With sufficient information on the composition of biofuels, researchers can significantly improve production processes.

Explanation:

Water in the blood helps carry nutrients and gases required foe survival througout the body. Which characteristics of water allow for this action?

A.water has a neutral pH
B.water maintains temperature
C.what expands when it freezes
D.water dissolves many compounds

Answers

Answer:

Water has a neutral pH

Explanation:

None of the others exactly fit in with what this is saying, and water having a neutral pH allows the supplies and nutrients that it carries to stay safe within it throughout the way.

Sorry if this isn't correct or full-fledged explained like I normally do, I saw you said to hurry up and I didn't do my normal research and whatnot.

Anyways, hope this helped!

Sources: N/A

The characteristic of water that allows this process of carrying nutrients and gases is water has a neutral pH. Thus, the correct option for this question is A.

What are the characteristics of water?

The characteristics of water are as follows:

It is a universal solvent. Due to the partial positive charge on hydrogen and partial negative charge on oxygen, it is a polar molecule. It has high heat capacity and high heat of vaporization. It has properties like cohesion and adhesion. Its solid form is less dense as compared to liquid.

Due to having the property of neutral pH, water significantly performs movement across the entire body with the help of blood.

It does not form any barrier with the differences in the level of pH. So, along with blood, water carries nutrients and gases that must be required for proper survival throughout the body.

Therefore, water that has a neutral pH is the characteristic property that allows the carrying of nutrients and gases required for survival throughout the body.

To learn more about The properties of water, refer to the link:

https://brainly.com/question/18681949

#SPJ6

Explain how cellular respiration is important for the production of ATP build on aerobic vs anaerobic

Answers

Answer and Explanation:

ATP is the energy molecule of the organism, being necessary for all cellular processes. It is produced in both aerobic and anaerobic respiration, but the processes are different.

Aerobic respiration, ATP is produced by breaking down the glucose molecule found in the food we consume. This process occurs in all organisms that need the presence of oxygen to survive. However, this is a complex process that occurs with the help of several enzymes and co-enzymes that perform various oxidation reactions on the glucose molecule, transforming it into carbon dioxide, water and ATP.

Anaerobic respiration is also known as fermentation and occurs in all organisms that cannot survive in the presence of oxygen. This process also occurs with the help of enzymes and coezimas, where the glucose molecule is degraded until it becomes two molecules of pyruvate. During the pyruvate degradation reactions, an ADP molecule is released, which will later be added to a phosphate molecule that is free in the cytosol, becoming ATP.

is the following truth or false? lava flows on the moon sometimes overlap highlands, showing that maria deposits are younger than highlands

Answers

Answer:

false

Explanation:

Other Questions
Describe the rock layers shown in Diagram A and any forces acting on the rock. If 5 shirts and 5 sweaters cost $205, and 6 shirts and 9 sweaters cost $294, what is the cost of one shirt and what is thecost of one sweater? )4. Which statement describes how the author developstheir analysis of the Hero's Journey?O A The author describes the structure of the Hero'sJourney and then explores how it translates topopular books,OB The author discusses the Hero's Journey asCampbell describes it and then shows how it haschanged over time,O c The author describes what the Hero's Journey is andthen discusses the pros and cons of following such astructure,OD The author discusses Campbell's discovery of theHero's Journey and then explores how the structureof stories has changed since then, T/F The outer planets have solid surfaces that are very rocky and dense Ms. O'Conner took a poll of 80 students to find out how they get to school. How many more students get to school on a bus than in a car? It refers to the possession of control, authority, and influence over others Portraying various personas differs from imitating someone because ourpersonas:A. completely conceal our personalities.B. are like people we have never met.C. cannot adapt to different scenarios.D. contain some aspect of our true self. What is the measure of angle ZUV? * 7. Find the value of x. Jessica got fast food for lunch. Jessica paid 3.10 dollars on fries and 4.88 on the sandwich with a $10 bill. Jessica got a combo deal. What was the change from the purchase? All types of exercise are appropriate at any age.Please select the best answer from the choices providedTF Simplify 15 Times Square root of 0.16c^12 French worksheet help needed!! 20 points for correct answer, thanks!!! Which of the following activities uses the most groundwater in agricultural areas?irrigating farmlandcleaning cropsdrinking and bathingdomestic activities What was the annual cost for maintaining a field slave? Help Please !!!,!,!,!,!! Determine the discriminant and then state how many solutions there are and the nature of the solutions. Do not solve. 6x^2-x-2=0 A rigid, insulated vessel is divided into two compartments connected by a valve. Initially, one compartment, occupying one-third of the total volume, contains air at 500oR, and the other is evacuated. The valve is opened and the air is allowed to fill the entire volume. Assuming the ideal gas model with variable specific heats. Determine: a. the final temperature of the air (in oR) b. the amount of specific entropy produced (in Btu/lbm oR) Which of the following was a result of the Soviet Union testing nuclear weapons?1) American began peace talks with the Soviet Union 2) Americans began to build fallout shelters in case of a nuclear attack 3) the government built up military technology to defeat nuclear missiles4) America became isolationist to focus on defense of the country. The length of a rectangular garden is 555 meters long. The area of the garden is 101010 square meters.P.S NEED HELP