In your opinion, how important are community organizations in building friendships between people of different backgrounds?

Answers

Answer 1

Explanation:

Building relationships with people from different cultures, often many different cultures, is key in building diverse communities that are powerful enough to achieve significant goals.

As people work on challenging problems, they will have to hang in there together when things get hard.

Related Questions


The difficulties associated with the
Documentation of African history.​

Answers

Answer:

Writing African history has been challenging and mostly difficult, due to a lack of both comprehensive written records and holistic archaeological evidence that covers all the zones of Africa from past times.

The major challenges to historical research revolve around the problems of sources, knowledge, explanation, objectivity, choice of subject, and the peculiar problems of contemporary history. Sources The problem of sources is a serious challenge to the historian in the task of reconstructing the past.

According to this imperial historiography, Africa had no history and therefore the Africans were a people without history. They propagated the image of Africa as a 'dark continent'. ... It was argued at the time that Africa had no history because history begins with writing and thus with the arrival of the Europeans.

Once a Constitutional Amendment has been proposed (either by the States or the federal legislature), which of the selections below is the next step in the ratification process?
Select one:
A. the Amendment being signed into law by the President
B. national referendum on the amendment
C. ratification by the individual states
D. judicial review by the Supreme Court of the United States

Answers

The correct answer is C) ratification by the individual states.

Once a Constitutional Amendment has been proposed (either by the States or the federal legislature), the selection below that is the next step in the ratification process is "ratification by the individual states."

Constitutional amendments must be approved by three-fourths of the states.

The founding fathers designed the proper system to amend the Constitution, since the Constitutional Convention times in Philadelphia, Pennsylvania.

The famous Bill of Rights, written by James Madison, is the first ten amendments to the United States Constitution that were ratified in 1791 and needed the approval of three-fourths of the states to make them valid. The Constitution has been amended 27 seven times. The last one was the 27th, passed to prohibit legislators to raise their own salaries.

Why did some athenian leaders think the socratic method was dangerous?

Answers

Answer:

This is of course somewhat of a subjective question, but in general most would agree that the reason they found these ideas so disturbing was because they shook their traditional belief system.

Explanation:

Which giants might Newton have been referring to when he said "If I have seen further than others it is by standing on the shoulders of giants."

Answers

Robert Hooke as an insult because he was short

After paraphrasing the Dalai Lama’s beliefs, fill in the third column of the table. Explain how his ideas reflect the Buddha’s teachings. Write a sentence or two to explain how these ideas connect to the Four Noble Truths and the Eightfold Path. Be sure to base your answers on what you learned in the lesson.

Answers

Explanation:

The Noble Eightfold Path, as depicted in the Fourth Noble Truth, is a Buddhist method for achieving the end of suffering. Right Understanding, Right Thought, Right Speech, Right Action, Right Livelihood, Right Effort, Right Mindfulness, and Right Concentration are the steps of the Noble Eightfold Path.

what's 2x984+95325 this so hard helppp

Answers

Explanation:

the answer is 97293, use a calculator and you will be ok!

Answer:

97293

Explanation:

You would first multiply 2 and 984 to get 1968, because of order of operations and then you add 1968 and 95325 to get 97293.

Name 4 of the new
countries created
in the Treaty of
Saint-Germaine
-en-Laye in 1919.

Answers

Explanation:

Austria

Hungary

Czechslovakia

Yugoslavia

Which part pf Congress has the power to impeach?

Answers

Answer:

House of Representatives

Explanation:

Which statement best captures the significance of judicial review

Answers

Judicial review, power of the courts of a country to examine the actions of the legislative, executive, and administrative arms of the government and to determine whether such actions are consistent with the constitution. Actions judged inconsistent are declared unconstitutional and, therefore, null and void.

Which one is it? NO LINKS​

Answers

Answer:

a. trade with Europe expands

I believe the answer is A. If it’s wrong blame the person above. If it’s right it’s cause I’m smart.

What are the answers to these questions?:

Answers

Answer:

1. Philosophier and revolutionary

2. Communism

3. The working class would rise up and overthrow the owners of industry

Explanation:

PLEASE HELP ME GUYS!!!

your friend finds the area of the parallelogram...
(imagine above)

is your friend correct?

yes or no, explain your reasoning

I REALLY NEED HELP

(BTW IM MARKING BRAINIEST!!)

Answers

Answer:

No, the friend is incorrect

Explanation:

The area of a parallelogram is calculated by multiplying the base length by the height. The base length would be 8 m for this parallelogram in particular.

This "height" needs to be a length perpendicular to the base (meaning that it makes a right angle with the base). This would make the height the length measuring 13 m.

Below is how to solve for the area correctly:

[tex]A=bh\\A=8(13)\\A=8(13)\\A=104[/tex]

I hope this helps!

Which of the following was not an effect of the Federal-Aid Highway Act of 1956?

It funded more than 41,000 miles of interstate highways.
It enabled faster transportation across the United States.
It added freeways to cities, encouraging the growth of suburbs.
It increased demand for shipping and railway transportation.

Answers

Answer:

It increased demand for shipping and railway transportation.

Explanation:

The Federal-Aid Highway Act of 1956 was famously referred to as the National Interstate and Defense Highways Act. This Act was enacted by the 84th US Congress on the 29th of June, 1956 and signed into law by President Dwight D. Eisenhower.

The effect of the Federal-Aid Highway Act of 1956 include the following;

I. It was used to fund over 41,000 miles of interstate highways in the United States of America.

II. It enabled a faster means of transportation across the United States of America.

III. Freeways were significantly added to cities and as a result of this, it encouraged the growth of suburbs.

Answer:

D. It increased demand for shipping and railway transportation.

Explanation:

D is correct

Why did American Indians occupy Alcatraz?

to bring attention to the US government’s unfair treatment of American Indians
to protest the increasing number of incarcerated American Indians
to establish a reservation on Alcatraz Island
to ensure American Indians had religious freedom to practice their beliefs

Answers

Answer:

to establish a reservation on Alcatraz Island.

Explanation:

In November 1969, a group of Native American activists comprising of 78 Indians (Indians of all tribes) occupied the Alcatraz Island in San Francisco Bay and held it hostage for nineteen (19) months in order to raise awareness about the past injustices, unfair treatment, and other contemporary problems the Native Americans were facing at the time.

Hence, the reason why the American Indians occupy Alcatraz was to establish a reservation on Alcatraz Island after reclaiming the land by right of discovery and based on the standards of the white man.

The American Indians proposed to buy Alcatraz Island for twenty-four dollars like the white men did about three centuries earlier.

Answer:

a

Explanation:

Why do you think the Cold War ends?

Answers

Answer:During 1989 and 1990, the Berlin Wall came down, borders opened, and free elections ousted Communist regimes everywhere in eastern Europe.

Explanation: In late 1991 the Soviet Union itself dissolved into its component republics. With stunning speed, the Iron Curtain was lifted and the Cold War came to an end.

what is the history of term of abolition​

Answers

Abolition is the act of getting rid of something, like the abolition of slavery.

Answer:

Abolition referred to the history of movements and acts of trying to abolish a system, practice, or institution. The most notable example of this was the abolitionist movement in the United States where many Northerners wanted to abolish the institution of slavery due to it's inhumane practices and lack of need in a world where industrialization was more potent in economic development.

Explanation:

Which political party did Adolf Hitler lead in 1920?(1 point)

USSR

Anti-Comintern Pact

German Workers' Party

National Socialist German Workers' Party

Answers

Answer:

National Socialist German Workers' Party

Explanation:

Who was it that paid for these voyages across the Middle Passage?

Answers

Voyages on the Middle Passage were large financial undertakings, generally organized by companies or groups of investors rather than individuals.

Generally those investors were either traders or businessmen who wanted slaves.

What significance do separation of powers, limited government, and checks and balances have in our American democracy

Answers

Answer:

Separation of Powers in the United States is associated with the Checks and Balances system. The Checks and Balances system provides each branch of government with individual powers to check the other branches and prevent any one branch from becoming too powerful.

Yet panics, in some cases, have their uses; they produce as much good as hurt. Their duration is always short; the mind soon grows through them, and acquires a firmer habit than before.
Meaning?

Answers

Oh ok I’m gonna be a little bit

Why did the Emancipation proclamation "omit", or leave out, freeing slaves in the border states?

Answers

Answer:

Lincoln exempted the border states from the proclamation because he didn't want to tempt them into joining the Confederacy. Because the proclamation was a temporary war measure, it later had to be codified into law with the 13th Amendment to the Constitution.

Explanation:

what best describes a manor

Answers

Answer:

That's my answer for you.

What year did the Soviet Union dissolve

Answers

Answer:

December 26, 1991

Explanation:

plz like

In London, during the early to mid - 18005 , how many children of the poor died before the age of one?

Answers

I don't know the exact answer but it was about 25% of children.

What happens to prices in when there is a free competitive market?

Answers

Answer:

Competition among sellers lowers costs and prices, and encourages producers to produce more of what consumers are willing and able to buy. Competition among buyers increases prices and allocates goods and services to those people who are willing and able to pay the most for them.

Explanation:

What is a reason WHY most
tornadoes happen in the middle of the
United States?

Answers

Most tornadoes are found in the Great Plains of the central United States – an ideal environment for the formation of severe thunderstorms. In this area, known as Tornado Alley, storms are caused when dry cold air moving south from Canada meets warm moist air traveling north from the Gulf of Mexico.

HOPE THIS HELPS

i first put in the c.h.a.t now i put in the answer

Exercise 1
Directions: Complete the table below.
please help po​

Answers

Answer:

A. Element Name: Flourine

no. of electrons (e^-)=Atomic number (Z)=no. of protons (p^+)

no. of neutrons (n^0)=Atomic mass-no. of protons (p^+) i.e. (n^0)=10

B. Element Name: Neon

Atomic mass=no. of electrons/protons + no. of neutrons i.e. 10+10=20

no. of protons (p^+)=no. of electrons (e^-)=Atomic number (Z)=10

Charge= -2

Explanation:

Charge is the tendency of an atom to lose or gain an electron. The gaining of electron is a positive charge (+) and the losing of an electron is a negative charge (-).

pls help!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

D

Explanation:

It's D. Just d. Right under Italy

Answer:

d

Explanation:

I need 5 Brainliest before I can become expert

How did Horace Mann contribute to the reform in education?

A. His development of books with raised letters aided in the education of the blind,

B.His educational philosophy led to a new approach to educating the deaf.

C.His radical call for classroom equality gave African Americans a chance to get an education.

D.His pressure on the state legislature provided money to fund new schools and increase teachers' pay.​

Answers

Answer:

Either A or D

Explanation:

The correct answer is - Either A or D

i.e.

Either A. His development of books with raised letters aided in the education of the blind

Or D.His pressure on the state legislature provided money to fund new schools and increase teachers' pay.​

How can a bill become law if the governor has vetoed it? Check all that apply.
The veto can be stopped by a member of the state supreme court.
The veto can be overridden with a two-thirds-majority vote by both houses.
The bill can be sent to the federal government for senatorial backing.
The bill can return to the legislature for adjustments or changes before resubmission.
The bill can go back through congress and be made law by a special committee.

Answers

Answer: It’s B and D

Explanation: The comment below is right

Answer:

b and d

Explanation:

got it right

Other Questions
giving brainliest !!!!!!! What is equivalent to x+y+x+y+3(y+5)? explain the major resources of energy and write its impoetance What is the fraction equivalent of 430%NO LINKS. IF WRONG I WILL DELETE. I need this plz help In romeo and juliet passage 1 line 64, what does the phrase, content thee most closely mean?A. Be satisfiedB. Be rationalC. Be stillD. Be grateful Diego bought some raisins and walnuts to make trailmix. Raisins cost $4 a pound and walnuts cost $8 apound. Diego spent $15 on both ingredients. Decide ifeach pair of values could be a combination of raisinsand walnuts that Diego bought.Explain your answer. HELPP!!!!!!!!!!!!!!!! What transformation is shown below?reflectioncan't be determinedrotationtranslation In triangle ABC, angle A measures 50.5 degrees and angle B measures 74 degrees. What is the measure of angle C? DO NOT TRY TO PUT A DEGREE SIGN. JUST TYPE THE ANSWER!! - 1:Translate the following sequence into a short protein. Add hyphens between,please.235'- AUG GCA AAA GAG GAA CAU UAA - 3'56Second LetterUAGPheTyrSerUUUUUUCUUAUUGUCUUCCUCAUCGUAUUACUAAUAG39LeuStopStopUGUCys UUGCUGA Stop AUGG Trp GCGUCGCArgCGAGHisProCUUC | CCCUACUGCCULeu CCCCCACCGCAUCACCAACAGGin121st3rdCGGletterAsnSerlleAUUA AUCAUAAUGACUACCACAThrAAUAACAAAAAGAGUAGCAGAAGGU letterAG15Lys|ArgMet ACGAspGUUGGUCGUAGUGValAlaGCUGCCGCAGCGGAUGACGAAGAGGGUGGCGGAGGGGly|Duco18Gluhttp://biology.kenyon.edu/courses/biol114/Chap05/Chapter05.html1 Kailynn has been on a roll, and solving 5 math problems every 2.5 minutes. At this rae, how many problem will she solve in 30 minutes. What is the slope of the line in the graph? please help me with this please, this is due in a couple of minutes. Which states the best reason why Chapter 15 might be titled "Nest-Building"?The robin is building a nest in the garden.A nest is a symbol for a safe place where Mary and Colin can grow.The robins are a symbol for new life returning to the garden.Mary and Dickon want Colin to watch the robin building the nest. You estimate that there are 40 marbles in a jar. The actual amount is48 marbles. Find the percent error. Round to the nearest tenth of a percent. help me plz which formula should I use?? What is the pear harbor and what happened 1. When did Texas become a territory of the United States? 5 oranges are bought for $4.00 and later sold at $0.10 each .find the loss percent.