In a sequence of numbers, a4=9, a5=13, a6=17, a7=21, and a8=25.

Which equation can be used to find the nth term of the sequence, an?


an=9n+4

an=4n+9

an=7n−4

an=4n−7

Answers

Answer 1

Answer:

an=4n−7

Step-by-step explanation:

Just took the test hope this helps


Related Questions

Complete the factorization of 3x2 – 5x + 2
.


Answers

The answer is 3x2-5x+2

The cost of buying 1 DVD is $19.99. The cost of buying 1 CD is
$9.99. The cost of buying 3 DVDs and 5 CDs is given by the
expression 3 x 19.99 + 5 x 9.99. What is the total cost?

Answers

Answer: The Total $110

Step-by-step explanation:

I hope this is what you are looking for

Help please I need the signs to these equations. Picture down below

Answers

Can see the problem send another picture

Find the surface area and volume of the prism 5ft 4ft 3ft

Answers

Surface Area: 94 ft

Volume: 60 ft

1- 94 surface area 60 volume
2- 37 surface area 15 volume

I need help with my homework

Answers

Interesting question

Un kite MO= 12 in, LP= 5 in, and PN= 8 in. What is the perimeter of the kite?

a) 19.55
b)12.60
c)35.62
d)24.77

Answers

Answer:

C.....35.6204994 is the answer so round up to 35.63

I need help please!!!!!

Filling Out Your 1040
The second page of the 1040 is where you determine how much tax you owe or will be refunded. Use the numbered
icons and your W-2 to help you fill out this form. If any fields don't apply to you, leave them blank.

Answers

Answer:

here you go!!!

Step-by-step explanation:

the other answer might not fit your's

Step-by-step explanation:

so here's what I got

find the missing number so that the equation has infinitely many solution
2x + __= -4( x - 2) +6x

Answers

Answer:

8

Step-by-step explanation:

-4x+8+2x

2x+8

compare both sides

2x+__= 2x+8

it is 8

Your answer would be 8, have a lovely day (:

Find the volume of this sphere

Answers

I’m going say it’s 33.51.

i’m not 100% sure because i was always taught to use V = 4/3 π r³ to find the volume of a sphere and i just assume that’s what everyone else does.

But, when i used this formula, i was getting 8.38 but when i got that answer i pressed the equals sign again, twice (don’t ask why, i don’t know haha), and got 33.51.


This is probably no help at all but i hope it’s the right answer

There are 85 mini chocolates in a bowl. The ration of kit kats to hersheys bars is 8:7. About how many kit kats were there?

Answers

Answer:

45

Step-by-step explanation:

Total mini chocolates in a bowl= 85

ration of kit kats to hersheys bars = 8:7

ration of kit = 8

Total ratio= 15

Number of kit kats= ratio of kit Kat/ total ratio × total number of mini chocolates

Number of kit Kat = 8/15 × 85= 45

Hence, there are 45 kit kats present there.

Answer:

There were about 45 kit kats.

Step-by-step explanation:

With the information provided, you know that the the ratio of kit kats to hersheys bars is 8:7 and that there are 85 mini chocolates in a bowl, so to be  able to find the number of kit kats there first you can say that you have 15 units because if you add the numbers on the ratio 8+7=15. Then, you divide the total amount of mini chocolates by the units to find the number of chocolates in each unit:

85/15=5.66

Now, you can multiply the ratio of hersheys bars which is 7 for the number of chocolates per unit to find the amount of hersheys bars:

7*5.66=40

Finally, you can multiply the ratio of kit kats which is 8 for the number of chocolates per unit to find the amount of kit kats:

8*5.66=45

According to this, the answer is that there were about 45 kit kats.

Which cylinders have the same volume as the cylinder below? Check all that apply. A cylinder with height of 32 meters and diameter of 20 meters.

Answers

Answer:

10054.4m^3

Step-by-step explanation:

Given data

Height= 32m

Diameter= 20m

Radius= 10m

The expression for the volume of a cylinder is given as

V= πr^2h

Substitute

V= 3.142*10^2*32

V= 3.142*100*32m^3

Hence the volume is 10054.4m^3

Answer:

cylinder with a height of 8m and a diameter of40m

cylinder with a height of 128m and a diameter of 10m

Step-by-step explanation:

got it right on edge may 2021. also sub to Troy's Movies on you tube

Find the value of x​ . Round your answer to the nearest tenth.

Answers

I think its either 9 or 10

A balloon has a circumference of 16 cm. Use the circumference to approximate the surface area of the balloon to the nearest square centimeter.

804 cm2

326 cm2

256 cm2

81 cm2

Answers

Answer:

The answer is 256 cm 2.....

What is the missing constant term in the perfect square that starts with x^2+\dfrac{1}{2}xx

2

+

2

1



xx, squared, plus, start fraction, 1, divided by, 2, end fraction, x ?

Answers

Answer:

1/16

Step-by-step explanation:

Given the expression;

[tex]x^2+\dfrac{1}{2}x[/tex]

To find a constant that will make it a perfect square, we will use the square if the half of coefficient of x

Coefficient of x = 1/2

half of Coefficient of x = 1/2*(1/2)

Half of Coefficient of x = 1/4

square of the half of coefficient of x = (1/4)^2

square if the half of coefficient of x = 1/16

hence the constant that will make it a perfect square is 1/16

Inglés

A company starts to track the number of phone calls received each month. Information about the number of phone calls the company received the first three months of tracking is listed below.


• During the first month, the company received 5,650 phone calls.

• During the second month, the company received 30% more phone calls than in the first month.

• During the third month, the company received 10,283 phone calls.


What was the percent increase in the number of phone calls from the second month to the third month?

español


Una empresa comienza a realizar un seguimiento del número de llamadas telefónicas recibidas cada mes. La información sobre la cantidad de llamadas telefónicas que recibió la empresa durante los primeros tres meses del seguimiento se enumera a continuación.


● . Durante el primer mes, la empresa recibió 5,650 llamadas telefónicas

● Durante el segundo mes, la empresa recibió un 30% más de llamadas que en el primer mes.

● Durante el tercer mes, la empresa recibió 10,283 llamadas telefónicas.


¿Cuál fue el porcentaje de aumento en la cantidad de llamadas telefónicas del segundo mes al tercer mes?

Answers

Answer:

c and b

Step-by-step explanation:

HELP NEEDED!!! 15POINTS FOR A ANSWER AND EXPLANATION! I cant figure this out help me please! Also no links.

Answers

Answer:

Line I:y=5

Line m:y=_2×+5

Line n:y=×-1

Line p:×=_5

Step-by-step explanation:

Hope It Help

Brainliest Please

Answer this please i am stuck

Answers

Answer:

adasdasdadsads

Step-by-step explanation:

Answer:

its impossible

Step-by-step explanation:

PLEASE HELP GEOMETRY IVE BEEN STUCK FOR HOURS!!! Show work

Answers

Answer:

O

Step-by-step explanation:

sohcahtoa

tan = O/A

tan x = 11.9/10

x = 50°

BA = hypotenuse

AC = adjacent

BC = opposite

Answer:

O

Step-by-step explanation:

11.9/10 = 50

Mhanifa can you please help me? This is due soon. I will mark brainliest!!

Answers

Answer:

6) 197) 22

Step-by-step explanation:

Diagonals of a rectangle are congruent#6

JL = KM

3x + 4 = 4x - 14x - 3x = 4 + 1x = 5

JL = 3*5 + 4 = 19

#7

JL = KM

2x - 6 = 3/2x + 12x - 3/2x = 1 + 61/2x = 7x = 14

JL = 2*14 - 6 = 22

Answer:

JL = KM

3x + 4 = 4x - 1

4x - 3x = 4+1

X= 5

JL = 3*5 + 4 = 19

JL = KM

2x - 6 = 3/2x + 1

2x - 3/2x = 1 + 6

1/2x = 7

X= 14

JL = 2*14 - 6 = 22

Write 3.5 • 4 using words

Answers

Answer:

I dont understand if you wanted the answer or just the equation, so I did both.

Three-point five times four

Three-point five times four equals fourteen.

Fourteen

Hope that helps!

If it did, plz mark brainiest, im trying to level up :3

Have a great day!

A function of x containing three ordered pairs of the form (x, y) is shown below. {(1, 3), (2, 7), (3, -9)}
What is the range of the function?​

Answers

Answer:

-9,3

Step-by-step explanation:

The range of the function is {3, 7, -9}.

What is a function?

A relation between a collection of inputs and outputs is known as a function. A function is a connection between inputs in which each input is connected to precisely one output. Each function has a range, co-domain, and domain.

Given:

A function of x containing three ordered pairs of the form (x, y) is shown below. {(1, 3), (2, 7), (3, -9)}.

The range of the function is,

= the number of value in the y-coordinate.

= {3, 7, -9}

Therefore, {3, 7, -9} is the range.

To learn more about the function;

brainly.com/question/28303908

#SPJ2

P deceased by the total of q and r

Answers

Answer:

P deceased by the total of q and r

Answer:

The answer is: p-(q+r)

Hope that helps. I just did it on my test and I got it right :D

Estimate the perimeter of the figure to the nearest whole number.

Answers

The correct answer is 19

1. Dois angulos correspondentes, de-
terminados por duas retas paralelas,
interceptadas por uma transversal,
medem 2x + 40° e -3x + 90°
a) Determine o valor de x.

b) Determine a medida de cada um dos
ângulos dados.​

Answers

Answer:

Step-by-step explanation:

dadds

help on this please,

Answers

Answer: (3) 11

ur welcome

Step-by-step explanation:

I need an answer to this perplexing math problem!


6-8 (8+27)=?

Answers

Answer:

-274

Step-by-step explanation:

Answer:

-274

Step-by-step explanation:

Write a number y divided by 6 as an expression.

Answers

Answer:

y ÷ 6.

Step-by-step explanation:

An expression is a combination of a number(s) and a variable.

Here, we simply need to write the expression from the word problem in mathematical form.

"Number" is unknown.

Variables are used to represent an unknown value.

(The variable in this expression is y).

The word problem says a number y divided by 6.

This simply means: y ÷ 6.

Una piramide tiene como base un hexagono regular de 6cm de lado y la altura de la piramide es de 10cm . Calcula la apotema de la piramide (altura de las caras triamgulares) y su area total

Answers

Answer:

a) 5.2 cm

b) 296.38 cm²

Step-by-step explanation:

a) Encontrar la apotema

La fórmula se da como:

A = s / 2 bronceado (180 / n)

s = Largo del lado = 6cm

n = Número de lados = 6 porque el polígono es un hexágono

Por eso,

Apotema = 6/2 × bronceado (180/6)

= 6/2 × tan 30

= 5.1961524227cm

Aproximadamente = 5.2 cm

Apotema = altura de las caras triangulares = 5.2cm

b) Superficie total

Área de superficie de una pirámide hexagonal = 3√3 / 2b² + 3b√h² + 3b² / 4

b es la longitud de la base. = 6cm

s es la altura inclinada. = 10cm

3√3 / 2 × 6² + 3 × 6√10² + 3 × 6² / 4

A = 296.38 cm²

393/9 with remainder

Answers

Answer:

43 remainder of 6.

Step-by-step explanation:

Simplify the following expression. 3x ^ 4 + 2x ^ 3 - 5x ^ 2 + 4x ^ 2 + 6x - 2x - 3x ^ 4 + 7x ^ 5 - 3x ^ 3

Answers

Answer:

[tex]7x ^ 5 - x ^ 3- x ^ 2 + 4x[/tex]

Step-by-step explanation:

1) [tex]3x ^ 4 + 2x ^ 3 - 5x ^ 2 + 4x ^ 2 + 6x - 2x - 3x ^ 4 + 7x ^ 5 - 3x ^ 3[/tex]

Rearrange the expression.

2) [tex]7x ^ 5+3x ^ 4- 3x ^ 4 + 2x ^ 3 - 3x ^ 3- 5x ^ 2 + 4x ^ 2 + 6x - 2x[/tex]

Solve.

3) [tex]7x ^ 5 - x ^ 3- x ^ 2 + 4x[/tex]

Other Questions
someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others. Which detail from paragraphs 22-25 best supports the concept of the "democratization" of social media in paragraph 22?A "mainstream media and institutions tend to invisibilizewomen, Howard says, the truth is getting more and moredifficult to ignore as these women so visibly lead the charge (Paragraph 22)B "they're working on a Juneteenth celebration with food trucks, speakers and performers - something to bring people together as the nation commemorates the end of slavery" ( Paragraph 23)C "Thomas anticipates she'll be busy organizing more events throughout the summer" (Paragraph 24)D "We're going to be dedicating our time to this to make sure things actually happen, Thomas says." ( Paragraph 25) Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down How does learning a different language helps you with communication skills find the area of the triangle answer in digital format only Malcolm is filling bags with rice. He starts with a 5 1 over 4 pound container of rice and fills eachbag with pound of rice. How many bags of rice can Malcolm fill? Name that meme -For 50 Points The school nurse took care of five students on Monday and four of the five students had a cough. The school nurse determined that 80% of the students in her school were coming down with colds. Which of the following would best describe why her conclusion was invalid? Calculate the speed of an object that travels 75m in 15s. Write and Solve Equations-Word ProblemsFor each context, draw a model, write an equation, and then write a complete sentence to answer the question in the context. If you were asked to round the number 9.6173 to the nearest hundredths place, how many digits would you have after the decimal point? the process of preparing and setting up a software on a computer is called what was explained by darwins theory of biological evolution John wanted to buy his favorite rubber shoes. Its original price is $105. He is lucky today because the shoes that he wanted to buy is 30% off the original price. How much will John pay now for his shoes? Find the value of x. Then find the mB and mC. Why/how did the Black Identity or Black Arts Movement influence visual art?