i’ll award brainliest! no links

Given ABC is congruent to XYZ. If AC = 10, determine the length of YZ.

Ill Award Brainliest! No Links Given ABC Is Congruent To XYZ. If AC = 10, Determine The Length Of YZ.

Answers

Answer 1
YZ=8.66 see pic for work
Ill Award Brainliest! No Links Given ABC Is Congruent To XYZ. If AC = 10, Determine The Length Of YZ.

Related Questions

60 POINTS! (Reported if incomplete/absent)
Three neighbors plan to complete fencing projects this spring. As shown in the diagrams below, Neighbor A plans to fence in his rectangular backyard with a 6-foot tall wooden privacy fence. Neighbor B plans to construct a circular chain link fence around his pool. And, Neighbor C is putting a vinyl fence around three side of his front yard. Note: Diagrams are not drawn to scale. Intended fences are marked with a dashed line.

Answers

Answer:

- The neighbor that has the most amount of fence to put up is: Neighbor A.

- The neighbor that has the least amount of fence to put up is: Neighbor C.

Step-by-step explanation:

To calculate the amount of fence that Neighbor A has to put up, you need to add the following distances:

Convert yards to feet (Remember that :

To calculate the amount of fence that Neighbor B has to put up, you need to use the formula for calculate the circumference of a circle:

Where r is the radius.

In this case, the radius is:

Substituting, you get:

To calculate the amount of fence that Neighbor C has to put up, you need to add the following distances:

Therefore, the neighbor that has the most amount of fence to put up is: Neighbor A.

The neighbor that has the least amount of fence to put up is: Neighbor C.

hope this helps btw i just copy and pasted this so its not my work

Answer:

- The neighbor that has the most amount of fence to put up is: Neighbor A.

- The neighbor that has the least amount of fence to put up is: Neighbor C.

Step-by-step explanation:

If the value of 6 coins is $0.56, what are the coins?​

Answers

Answer:

1 quarter, 2 dimes, 2 nickels, and 1 penny.

A line that passes through the point (-3,-6) has a slope of 4/3. What is another point on this line

Answers

Answer:

3,3

Step-by-step explanation:

Six friends attend a music concert and spend $27 per ticket. They each purchase a souvenir t-shirt. If the friends spend a total of $231, how much does each souvenir t-shirt cost

Answers

Answer:

11.50

Step-by-step explanation:

6x27=162

231+-162=69

69 divided by 6 is 11.5

11.5=11.50

11.50 is your answer

Answer:

$11.50.

Step-by-step explanation:

If there are 6 friends, and every ticket costs $27, then we need to multiply.

6 x 27 = 162.

Then, we subtract the cost of the tickets so we can find the total cost of the souvenir t-shirts.

231 - 162 = 69.

Since each of the 6 friends bought a souvenir t-shirt, we divide the total cost by the number of people.

[tex]\frac{69}{6}[/tex] = 11.5.

So, each t-shirt costs $11.50.

Please help!! Will give brainliest! Giving lots of points!

Answers

Answer:

d) [tex](9*3/4)+y[/tex]

Step-by-step explanation:

b) [tex]9+y*(3/4)[/tex]

This expression is not equivalent, as the original expression, [tex]y+9*\frac{3}{4}[/tex] , has 9 multiplied to [tex]\frac{3}{4}[/tex] instead of y. You can interchange values like this when it comes to addition, but not multiplication.

c) [tex](y+9)(3/4)[/tex]

This expression is also not equivalent. After opening up the parentheses, it would again result in y being multiplied to [tex]\frac{3}{4}[/tex].

[tex](y+9)(3/4)\\= y(3/4)+9(3/4)[/tex]

d) [tex](9*3/4)+y[/tex]

This expression is equivalent, as 9 and [tex]\frac{3}{4}[/tex] are still being multiplied together and y is added to the product. We can actually rearrange this to look like the original expression:

[tex](9*3/4)+y\\=y+(9*3/4)\\=y+(9*\frac{3}{4} )\\=y+9*\frac{3}{4}[/tex]

I hope this helps!

Marco got 15 questions wrong on his 30-question test. What is his grade as a percent?

Answers

Answer:

15

Step-by-step explanation:

The grade percentage of Marco is 50%.

What is percentage?

A percent is a dimensionless number, meaning that it has no units of measurement, since it represents a part of whatever whole is being measured.

Given that, Marco got 15 questions wrong on his 30-question test.

We need to find his grade as a percent,

So,

Since he got 15 answers wrong,

Therefore, his correct answers = 30-15.

That mean his grade in marks = 15

Now, his grade in percent = 15/30 x 100 = 50%

Hence the grade percentage of Marco is 50%.

Learn more about percentage click;

https://brainly.com/question/29306119

#SPJ2

{y= -1-3x
{y + 3x = 3

Answers

Answer:

No Solution.

Step-by-step explanation:

y=-1-3x

y+3x=3

------------

-1-3x+3x=3

-1=3

no solution

the answer to this is no solution! that’s what the other answer said haha

If (x + 8) = 10, determine the value of x.

Answers

Answer:

(x+8)= 10 so 8 subtracted from 8 is zero and 8 subtracted from 10 is 2 so the

the answer is 2

Find the next term in the sequence:
3/469, 9/469, 27/469, 81/469, ...

A. 243/469

B. 100/469

C. 27/156

D. 84/469

Answers

Answer:

A. 243/469

Step-by-step explanation:

Looking at the terms here, it seems that the this powers of 3 divided by 469.

3 is 3¹. 9 is 3². 27 is 3³. 81 is 3⁴.

Knowing that, then 3⁵/469 is the next term. 3⁵ is 243, so the next term is 243/469, which is A.

help m.e please please

Answers

Answer:

the answer is -2,-2

Step-by-step explanation:

30 points please I really need help

Answers

Answer :

$38 + $2(n) where n is the no. of cars.

Step-by-step explanation:

He earns $38 daily which is fixed and additional $2 wage depends on the no. of cars which means no. of cars will determine how many $2's he earns.

25 cars = $38 + $2 (25) = $88

30 cars = $38 + $2 (30) = $98

35 cars = $38 + $2 (35) = $108

40 cars = $38 + $2 (40) = $118

Which number of spins would most likely result in a relative frequency that is closest to the theoretical probability?


• 10 spins
• 50 spins
• 100 spins
• 400 spins

With the spinner shown the theoretical probability of landing on 2 is 0.25!​

Answers

Answer:

The answer is four since the probability is 1/4 in fraction form

Step-by-step explanation:

hope this helps!

A 4 pound force acting in the direction of (4,-2) moves an object just over 7 ft from point (0,4) to point (5,-1). Find the work done to move the object to the nearest foot-pound

Answers

Answer:

[tex]W=59.7408J[/tex]

Step-by-step explanation:

From the question we are told that:

Force [tex]f=4N[/tex]

Force Direction [tex]\arrow (4,-2)[/tex]

Distance traveled [tex]d_t=7ft \aprrox\ 2.1336m[/tex]

Distance traveled Direction point (0,4) to point (5,-1)

 

Generally the equation for work done is mathematically given by

 [tex]W=force*distance[/tex]

 [tex]W=f*d_t\\W=4*7*2.1336[/tex]

 [tex]W=59.7408J[/tex]

I need help with this question!

Answers

Answer:

h+c=28

4h+2c=80

Step-by-step explanation:

The total amount of horses and chickens is 28. So h+c=28. Each horse has 4 legs. Each chicken has 2 legs. There are h amount of horses and c amount of chickens. So 4h+2c=80.

h+c=28

4h+2c=80

When three squares are joined at their vertices to form a right triangle, the combined area of the two smaller squares is the same as the area of the largest square. Which three squares will support this statement?

Answers

I have no idea and I would like to inform you that I’m just not smart

Answer:

J

Step-by-step explanation:

Area of a square = L x W

F:

(5 x 5) + (4 x 4) = 81

25 + 16 = 81

41 = 81  INCORRECT =( X

H:

64 + (5 x 5) = (13 x 13)

64 + 25 = 169

89 = 169 INCORRECT =( X

G:

(6 x 6) + (5 x 5) = (7 x 7)

36 + 25 = 49

61 = 49 INCORRECT =( X

J:

144 + (5 x 5) = 169

144 + 25 = 169

169 = 169  CORRECT =)

Please Help!!!!
The drawing below shows a row of grocery carts that have "nested" together. The carts are each 32 in. long. Each cart after the first adds 11 in. Show how the length of the row depends on the on the number of carts. What would the length of a row of 20 nested carts be?

Answers

Answer:

241

Step-by-step explanation:

arithmetic sequence formula

A = a + f × (n-1)

n=the nᵗʰ term in the sequence

a=the first term in the sequence

f=the common difference between terms

31+11(20-1)=241

pls help help help help help ​

Answers

Answer:

y = -2

Step-by-step explanation:

When the input (x) is -5, we just look at where (-5) is on the x axis and see where the line is for the y-coordinate.

The line is at -2

What is the full answer to this??

Answers

Answer:

27.5

Step-by-step explanation:

Answer:

The answer is 187.5 inches

Step-by-step explanation:

If you do 15 x 12.5 you get 187.5

Which expression means the same as "25 less than 5y"?
A. 5y - 25
B. 25 - 5y
C. 5y - 25
D. 25 = 5y

Answers

Answer:

a) 5y - 25

Step-by-step explanation:

Solve using the quadratic formula 1

Answers

Answer:

Step-by-step explanation:

Unless we set x^2 + 8x + 15 equal to zero, we don't have an equation to be solved.  I will assume that the problem is actually x^2 + 8x + 15 = 0.

The coefficients of this quadratic are {1, 8, 15}, and so the "discriminant" b^2 - 4ac is (8)^2 - 4(1)(15), or 4.  Because the discriminant is positive, we know that there are two real, unequal roots.

Continuing with the quadratic formula and knowing that the discriminant is 4, we get:

      -8 ± √4           -8 ± 2

x = ---------------- = --------------- , or x = -2 ± 1:  x = -3 and x = -5

          2                       2

If 10 apples cost $8.95, how much will 4 apples cost?

Answers

Step-by-step explanation:

here's your solution

=> cost of 10 apple = $ 8.95

=> cost of 1 apple = $8.95/10 = $ 0.895

=> cost of 4 apple = $ 0.895*4

=> cost = $3.580

hope it helps

Mathhhhhhhhhhhhhhhhhhhh

Which statement applies?

Answers

Answer:

it is the first one because you would be deciding by 2

Multiply the polynomials. (2x2 + 6x + 6)(3x - 2)​

Answers

22 because 2x2=4+6=10+6=16 3x2=6 witch means u add 16+6 and that is 22

pls i'll give brainliest answer these four for brainliest

Answers

Answer:

294 teenagers

Step-by-step explanation:

31.5$

102ml

50 hamburgers

Step 1: Our output value is 700.

Step 2: We represent the unknown value with $x$x​.

Step 3: From step 1 above,$700=100\%$700=100%​.

Step 4: Similarly, $x=42\%$x=42%​.

Step 5: This results in a pair of simple equations:

$700=100\%(1)$700=100%(1)​.

$x=42\%(2)$x=42%(2)​.

Step 6: By dividing equation 1 by equation 2 and noting that both the RHS (right hand side) of both

equations have the same unit (%); we have

$\frac{700}{x}=\frac{100\%}{42\%}$

700

x​=

100%

42%​​

Step 7: Again, the reciprocal of both sides gives

$\frac{x}{700}=\frac{42}{100}$

x

700​=

42

100​​

Therefore, 42% of 700 is 294.

What is the quotient of the fractions below? 3/5 divided by 2/3?

A. 2/5
B. 10/9
C. 9/10
D. 5/2
HUURRYYY!!!

Answers

Answer:

9/10

Step-by-step explanation:

Markale sold his house for 175,000. If there is a 7% sales tax, how much money did he pay taxes

Answers

Answer:

12250

Step-by-step explanation:

can someone help me with this one 2x2-18=0

Answers

Answer:

-14

Step-by-step explanation:

Answer:

9

Step-by-step explanation:

2x-18=0

2x=18 /:2

x=9

HELPP ME PLSSSSSSS I NEED IT NOW PLSSS. How could you calculate the x-coordinate of the midpoint of a horizontal
segment with endpoints at (0,0) and (20,0)?

Answers

c? i’m pretty sure sorry if it’s wrong

Answer:

The correct answer is B: Count by hand and D: Divide 20 by 2

Step-by-step explanation:

I just got it correct.

How many solutions are there to this equation 3(3x-)=6x-3 please help

Answers

One Solution
Steps - 3(3x)=6x-3
9x=6x-3
-6x -6x
3x=3
X=1

PLEASE HELP!!
Find the volume of the following
square pyramid.
Help Resources
8 cm
6 cm
6 cm
V = [?] cm3
Enter

Answers

Answer:

96

Step-by-step explanation:

The volume of the square pyramid is 96 cm³.

How to find the volume of a square pyramid?

You can locate the extent of a normal square pyramid with the use of the volume formula= base location² × height / 3. Take be aware that the bottom vicinity equals the square of the pyramid's base side period. However, the peak is the perpendicular distance between the pyramid's base and the pyramid's vertex.

By using the given formula, we get

V= a² h/3

=6² * 8 / 3 = 96

The answer is 96 cm³.

The volume of a pyramid is found using the formula V = (1/3) B*h, where 'B' is the base area and 'h' is the height of the pyramid.

Learn more about the volume of a pyramid here: https://brainly.com/question/21510592

#SPJ2

Other Questions
Income statement under absorption costing and variable costingThe following information applies to the questions displayed below.Cool Sky reports the following costing data on its product for its first year of operations. During this first year, the company produced 42,000 units and sold 34,000 units at a price of $140 per unit. Manufacturing costs Direct materials per unit $60 Direct labor per unit $22 Variable overhead per unit $8 Fixed overhead for the year $504,000 Selling and administrative costs Variable selling and administrative cost per unit $12 Fixed selling and administrative cost per year $115,0001a. Assume the company uses absorption costing. Determine its product cost per unit. 1b. Assume the company uses absorption costing. Prepare its income statement for the year under absorption costing. 2a. Assume the company uses variable costing. Determine its product cost per unit.2b. Assume the company uses variable costing. Prepare its income statement for the year under variable costing. Fire: heat as night : darkness analogy luciana is adding water to a pool Jacob was assigned recently to a large team working on a major software release that was taking longer than expected. Jacob and the other latecomers into the project spent a month partnered with a senior programmer who went over the project in detail with them and got them up to speed. Unfortunately, this training put the project even farther behind schedule. After a few months of working on the project with many other programmers, Jacob's work output becomes noticeably lower than it was before when he was working independently. Jacob's reduced work output is most likely due to Help me out. Mathmatics someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others. Which detail from paragraphs 22-25 best supports the concept of the "democratization" of social media in paragraph 22?A "mainstream media and institutions tend to invisibilizewomen, Howard says, the truth is getting more and moredifficult to ignore as these women so visibly lead the charge (Paragraph 22)B "they're working on a Juneteenth celebration with food trucks, speakers and performers - something to bring people together as the nation commemorates the end of slavery" ( Paragraph 23)C "Thomas anticipates she'll be busy organizing more events throughout the summer" (Paragraph 24)D "We're going to be dedicating our time to this to make sure things actually happen, Thomas says." ( Paragraph 25) Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down How does learning a different language helps you with communication skills find the area of the triangle answer in digital format only Malcolm is filling bags with rice. He starts with a 5 1 over 4 pound container of rice and fills eachbag with pound of rice. How many bags of rice can Malcolm fill? Name that meme -For 50 Points The school nurse took care of five students on Monday and four of the five students had a cough. The school nurse determined that 80% of the students in her school were coming down with colds. Which of the following would best describe why her conclusion was invalid? Calculate the speed of an object that travels 75m in 15s. Write and Solve Equations-Word ProblemsFor each context, draw a model, write an equation, and then write a complete sentence to answer the question in the context. If you were asked to round the number 9.6173 to the nearest hundredths place, how many digits would you have after the decimal point?