Fill in the blanks with the correct form of the verb Tener. (tenemos, tienes, tengo,
tienen, tiene)
Yo
dos hermanos. Mi hermano menor
quince años y mi
hermana mayor
diecinueve años. Nosotros
un perro
adorable. Nuestro perro
siete años. Y tú, ¿
hermanos?
¿Cuántos hermanos
? ¿
ustedes una mascota? ¿Qué
, un perro o un gato? Nosotros
una familia grande. La
familia
diez personas. Yo
cinco sobrinos y Inis padres
cinco nietos.

Answers

Answer 1

Answer:

Yo "tengo"

dos hermanos. Mi hermano menor "tiene"

quince años y mi

hermana mayor "tiene"

diecinueve años. Nosotros "tenemos"

un perro

adorable. Nuestro perro "tiene"

siete años. Y tú, ¿ "tienes"

hermanos?

¿Cuántos hermanos

? ¿"tienes"

ustedes "tiene" una mascota? ¿Qué

"tienes", un perro o un gato? Nosotros "tenemos"

una familia grande. La

familia "tiene"

diez personas. Yo "tengo"

cinco sobrinos y Mis padres "tiene"

cinco nietos.

                     hope this helps you !

Answer 2

Yo tengo dos hermanos. Mi hermano menor tiene quince anos y mi hermana mayor tiene diecinueve anos. Nosotros tenemos un perro adorable. Nuestro perro tiene siete anos. Y tu, tienes hermanos? Cuantos hermanos tienes? Ustedes tienen una mascota? Que tienen, un perro o un gato? Nosotros tenemos una familia grande. La familia tiene cinco personas. Yo tengo cinco sobrinos y mis padres tienen cinco nietos.

The words in bold are the ones you need.

Hope this helps!!


Related Questions

3. fill in the blank with the appropriate possessive
adjective.
____(ellos) tarjeta de cumpleaños.
mis
o
sus
su
O tu

Answers

Answer:

I think it's "su"

Explanation:

Normally sus sounds better because it's plural like (ellos) but tarjeta would need an s at the need to make that work so I think "su"

Answer:

Su tarjeta de cumpleaños.

Explanation:

i need help ASAP. 25 Pointsss

Answers

Answer:

1. Asiste

2. Entran

3. Abrimos

4. escriben

5. aprendece

6. habla

7. vivo

8. corre

9. toma

10. partiremos

11. toca

12. cubre

13. trabaja

14. recibe

15. lee

Change the infinitive to agree with the indicated subjects Las companas_______mucho ruido.(producir)
Yo______cuando hat trabajo.(desaparecer)
Yo_____mucho ruido.(producir) Yo_____las cartas.(traducir) Luisa____a papa. (obedecer)
El chófer_____ el coche. (conducir) Yo_____ a papa. (obedecer)
Yo_____ al enfermo(conocer)
Yo_____solamente veinte centavos.( ofrecer)

Answers

Answer:

Las campanas producen (they produce) mucho ruido.

Yo desaparesco (I dissapear) cuando hay trabajo.

Yo produsco (I produce) mucho ruido.

Yo tradusco(i traduce) las cartas. Luisa obedece (she obeys) a papa.

El chofer conduce (the driver drives) el coche.

Yo obedesco (I obey) a papa.

Yo conozco (i know) al enfermo.

Yo ofresco (i offer) solamente veinte centavos.

Mark brainliest if helped ty

Choose the correctly conjugated (verb) in the present tense.



Juana, Elena y tú _______ (cantar) en la clase de español.

Group of answer choices

cantas

cantamos

cantan

canta

Answers

Answer is ... Cantan

can someone please help me with question 1-2

Answers

I think you need to listen to an audio to answer the questions. Can you please share the link ?

________ ponemos la mesa cada noche.
1. Vosotros
2. Nosotros
3. Ellos

Answers

Answer:

Nosotros

Explanation:

Ponemos is the nosotros form of poner.

Answer: Nosotros

Explanation: ponemos = we put
Remember if it has mos at the end its nosotros because you are talking about you and other people aka “we”

Cada tarde______ paseáis al perro.
1. nosotros
2. ellos
3. vosotros

Answers

Answer:

3, vosotros

Explanation:

3 , vosotros ye esi esta

ser (tú)Conjugation

Answers

Answer:

Tú eres

Explanation:

How many countries in South America have Spanish as their official language?
O 10
O 13
09
O 5

Answers

Answer:

nine countries

Explanation:

Answer:

9

Explanation:

9

Venezuela, Colombia, Ecuador, Perú, Bolivia, Paraguay, Uruguay, Chile, Argentina.

NO SENDING LINKS AS AWNSERS
For the following practice, type in the correct form of IR in the first box and in the 2nd box, type in
al
a la
a los
a las
Example:
Yo voy a la biblioteca

Yo __ __ restaurante con mi familia.

Mis amigos y yo __ __ cine

Uds __ __ museos

Yo __ __ teatro esta noche.

Andrés __ __ banco con su papá.

Vosotros__ __ oficina.

Uds __ __ tiendas

Los estudiantes __ __ fiesta

María y tú__ __ Esuela hoy

La amiga de Beto __ __ médico hoy.

Answers

1)Yo voy al restaurante con mi familia
2)mis amigos y yo vamos al cine
3)ustedes van al museo
4)yo voy al teatro esta noche
5)Andrés irá al banco con su papá
6)vosotros iréis a la oficina
7)uds van a las tiendas
8)los estudiantes van a la fiesta
9)Maria y tú van a la escuela hoy
10)la amiga de beto va al médico hoy

Answer:

Explanation:

Yo _voy_ _al_ restaurante con mi familia.  

Mis amigos y yo _vamos_ _al_ cine  

Uds _van_ _a los_ museos  

Yo _voy_ _al_ teatro esta noche.  

Andrés _va_ _al_ banco con su papá.  

Vosotros_ vais_ _a la_ oficina.  

Uds _van_ _a las_ tiendas  

Los estudiantes _van_ _a la_ fiesta  

María y tú_ van_ _a la_ Escuela hoy  

La amiga de Beto _va_ _al_ médico hoy

¡Hacemos arepas! Last night the Sánchez family made arepas. Their mother, doña Olga. Use the correct preterite to describe what happened.


mi hijo mayor, Oscar ____________ la harina de maíz con agua





mezcló


mezclé


mezclo


mezclaba

Answers

Answer:

A- Mezcló

I hope this helps, remember to oug the accent

The first one with the acent

en nuestra ninez,mi amiga y yo ____ de nuestros cuentos favoritos

Answers

Answer:

leemos

Explanation:

Escoge la major respuesta. ¿Cuántos cuesta esta pulsera?

A. Treinta dólares.
B. Es de mejor calidad.
C. Se aceptan tarjetas de crédito.

Answers

It is A because the other answers don’t make sense

ejemplos de la cronica sudario negro sobre el paisaje

Answers

Please include a picture of the passaje so i can help u out! Porfavor pon una foto de el passje para que te pueda ayudar!

Complete with the correct preterite verb form.WILL BRAINLIST IF CORRECT, will report if scam!

Answers

1) Yo hable con Juan ayer
Cuando tu hablaste con Juan

2) Yo tome un examen
En que clase tomaste el examen

3) Yo lo compre ayer
Cuando lo compraste tu

4) Nosotros nadamos en el mar
Y ustedes nadaron en la pisina

5) Nosotros pagamos cien pesos
Cuanto pagaron ustedes

6) Que pistas bajaron ustedes?
Nosotros bajamos las pistas para participantes

¡Hacemos arepas! Last night the Sánchez family made arepas. Their mother, doña Olga, explains what each person did. Use the correct preterito.


Yo_____________ a buscar los ingredientes.


busqué


busco


buscaba


busca

Answers

*yo busqué los ingredientes

Complete the following sentence using present progressive.
Mis padres
---(estar) -------_(planear) un viaje a Europa
cuándo esta pandemia termine.
Type your answer...

Answers

Answer:

planear

Explanation:

planear=plan is estar means is so his/her father is planning an trip to Europe❤

Please help, who knows Spanish good

Answers

Answer:

leer, comer, beber and caminar

Which person's profession is in the field of derecho?
A. una abogada
B. un diseñador
O C. una cartera
O D. un arquitecto

Answers

Answer:

A. Una abogada

it means a lawyer.

The answer is A una abogada

Please hurray!! spanish ser

Answers

Answer:

Explanation:

yo- soy  

nosotros- somos

tu- eres

vosotros- sois

el- es

ellos- son

1) Yo - soy
2) Nosotros/Nosotras - somos
3) Tú - eres
4) vosotros/ vosotras - sois
5) El/Ella - es
6) ellos/Ellas - son

conjugate two o to ue stem-changing verbs. Conjugate probar ("to test") and demostrar ("to demonstrate"). Write them in a verb chart

Answers

Answer:

Probar:

https://www.spanishdict.com/conjugate/probar

Demonstrar:

https://www.spanishdict.com/conjugate/demostar

Dont anwser with a link
Type the appropriate ending in the blanks.

Use uppercase OR lowercase
**Don't forget accents! áis has accent over the a like this: á

mirar = to look
mir__=I look
mir__=she looks

terminar = to end / to finish
termin__=they end/finish
termin__=we end/finish

trabajar = to work
trabaj__=he works
trabaj__you (sing./fam.) work

enseñar = to teach
enseñ__=we teach
enseñ__=they teach

buscar = to search
busc__=I searcj
busc__you all (formal) search

Answers

Answer:

I look = Yo miro

She looks = Ella mira

They end/finish = Ellos terminan

We end/finish = Nosotros terminamos.

He works = El trabaja

You work = Tu trabajas

We teach = Nosotros enseñamos

They teach = Ellos enseñan

I search = Yo busco

You all search = Ustedes buscan

De nada! (You're welcome)

- Indica si los enunciados son correctos (C) o Incorrectos (1). Corrige lo incorrecto
a- El condiloma es producido por una bacteria portada por los humanos ()
b)- El condiloma es una enfermedad leve y absolutamente benigna (( )
c)- El agente causal del papiloma es el virus del papiloma humano (
d)-El papiloma es una enfermedad infecciosa que afecta la piel ()
e) El herpes se puede prevenir sólo con abstinencia sexual ( )​

Answers

A. CORRECTO
B. CORRECTO
C. EL AGENTE CAUSANTE DEL PAPILOMA ES EL VIRUS PAPILOMA HUMANO
D. CORRECTO
E. CORRECTO

A qué crees que se deba la diversidad lingüística en el español ??

ayudaaaaa plisssss

Answers

Answer:

Explanation: La diversidad lingüística es un patrimonio que Hispanoamérica debe

CVC. SICELE. La diversidad lingüística del español en el ...https://cvc.cervantes.es › sicele › 006_matiasmonhele

La alfombra _____ debajo de la cama.
1. es
2. son
3. está

Answers

3. está

(Why? Estar is used when describing place/location.)
answer3) está...........

Explica la postura del narrador en la presentación del personaje de doña perfecta


Answers

Es una lectura?Si lo es publicala para poder ayudar

how many supporters met chavez and his fellow marchers at the end of their pilgrimage

Answers

Chavez and a group of strikers set out on a 340-mile march from Delano to Sacramento to draw attention to plight of farm workers Thousands of supporters joined the marchers.

Need help with Spanish pleaseee

Answers

Answer:  me pongo

Explanation: You put yourself to do something so (pongo)

En mi tiempo libre me pongo a tocar la guitarra y jugar baloncesto

el siguiente fragmento del poema Himno al nueve de octubre. En caso de cambiar o agregar alguna palabra, ten en cuenta la correcta selección del vocabulario. Por ser libre, valor y constancia en los campos de Marte mostró; por guardar ese bien tan preciado muestra siempre constancia y valor. Y cual brillan los signos celestes en la esfera con vivo esplendor, brillará más hermosa en la tierra la menor de las hijas del Sol.

Answers

Answer:

Una palabra que podríamos cambiar seria "cual" por la palabra "como".

Explanation:

Podemos notar en la última estrofa del poema que se está hablando de una comparación, porque se está haciendo referencia a la manera como brillaría la menor de las hijas del sol que será igual o parecida a " como brillan los signos o  celestes"

Con el cambio de la palabra el fragmento del poema queda de la siguiente manera:

Por ser libre, valor y constancia

en los campos de marte mostró;

por guardar ese bien tan preciado

muestra siempre constancia  y valor.

Y como brillan los signos celestes

en la esfera con vivo esplendor,

brillará más hermosa en la tierra

la menor de las hijas del sol.

You will be graded on (1) evidence of research conducted, (2) appropriateness of response, and (3) overall quality of your response. In paragraph one describe where your person is from, and what line of work they do/did. Include interesting details about the person's life and events that the person has/had experienced that are significant. Give a time frame of when these events occur. In paragraph two describe his/her important contributions to their country, to Spanish speaking culture, their career, etc. What made this person famous or historical? Why do they stand out above all the others? If this person created something (art, music, legislation, literature), what are your thoughts about a particular work? If this person liberated or fought for something, what is one question you may want to ask them? You may use outside sources (Internet, books, magazines, etc.) to gather information for this assignment. However, be sure not to copy the information directly from those sources. HELP ME PLEASE!!!!!!!!!!!!!!!!

Answers

Answer: necesito puntos disculpa

Explanation:

Sorry

Other Questions
Explain how the islands of Sicily and Sardinia positively impacted ancient Romans. Income statement under absorption costing and variable costingThe following information applies to the questions displayed below.Cool Sky reports the following costing data on its product for its first year of operations. During this first year, the company produced 42,000 units and sold 34,000 units at a price of $140 per unit. Manufacturing costs Direct materials per unit $60 Direct labor per unit $22 Variable overhead per unit $8 Fixed overhead for the year $504,000 Selling and administrative costs Variable selling and administrative cost per unit $12 Fixed selling and administrative cost per year $115,0001a. Assume the company uses absorption costing. Determine its product cost per unit. 1b. Assume the company uses absorption costing. Prepare its income statement for the year under absorption costing. 2a. Assume the company uses variable costing. Determine its product cost per unit.2b. Assume the company uses variable costing. Prepare its income statement for the year under variable costing. Fire: heat as night : darkness analogy luciana is adding water to a pool Jacob was assigned recently to a large team working on a major software release that was taking longer than expected. Jacob and the other latecomers into the project spent a month partnered with a senior programmer who went over the project in detail with them and got them up to speed. Unfortunately, this training put the project even farther behind schedule. After a few months of working on the project with many other programmers, Jacob's work output becomes noticeably lower than it was before when he was working independently. Jacob's reduced work output is most likely due to Help me out. Mathmatics someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others. Which detail from paragraphs 22-25 best supports the concept of the "democratization" of social media in paragraph 22?A "mainstream media and institutions tend to invisibilizewomen, Howard says, the truth is getting more and moredifficult to ignore as these women so visibly lead the charge (Paragraph 22)B "they're working on a Juneteenth celebration with food trucks, speakers and performers - something to bring people together as the nation commemorates the end of slavery" ( Paragraph 23)C "Thomas anticipates she'll be busy organizing more events throughout the summer" (Paragraph 24)D "We're going to be dedicating our time to this to make sure things actually happen, Thomas says." ( Paragraph 25) Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down How does learning a different language helps you with communication skills find the area of the triangle answer in digital format only Malcolm is filling bags with rice. He starts with a 5 1 over 4 pound container of rice and fills eachbag with pound of rice. How many bags of rice can Malcolm fill? Name that meme -For 50 Points The school nurse took care of five students on Monday and four of the five students had a cough. The school nurse determined that 80% of the students in her school were coming down with colds. Which of the following would best describe why her conclusion was invalid? Calculate the speed of an object that travels 75m in 15s. Write and Solve Equations-Word ProblemsFor each context, draw a model, write an equation, and then write a complete sentence to answer the question in the context.