Explain the functions of a trade union. (6)

Answers

Answer 1

Answer:

Trade unions will organize strikes and demonstrations on behalf of worker demands. Fight for social welfare for workers. Promote and advocate for education and proper training for workers. Advocate and fight the government for legislative protection for workers.

Answer 2

Answer:

the functions of a trade union:

i. Increasing Co-operation and Well-being among Workers

ii. Securing Facilities for Workers

iii. Establishing Contacts between the Workers and the Employers

iv. Trade Unions working for the Progress of the Employees

v. Safeguarding the Interests of the Workers

vi. Provision of Labor Welfare

Hope it helps!!!


Related Questions

What is the proper balance between dealing with negative externalities through government regulation or through torts?

Answers

Answer:

Government regulation is the best way to deal with negative externalities

Explanation:

An externality is the effect of the activities ( mostly economic ) of an individual on third parties whom are not direct participants in such activities ( mostly economic ) and this externalities can be either positive or negative .

A proper balance by which Government can deal with negative externalities is by increasing taxes on the production of goods and services that leave a trail of negative externalities on  third parties. that way the cost of production of such goods and service will discourage its production

argue that use of english is important to chartered accountant​

Answers

Explanation:

There are several ways that a CA aspirant can become fluent in the English language. The best way is to take short-term English language classes that will give some fluency in English. There are several such English courses available from leading institutes in India. Also, you can take simple online English language courses to improve English language fluency.

English language fluency is important for CA aspirants. It’s not only necessary to pass all exams to become a CA but also in your routine work, after becoming a CA. Hence, learning English and becoming fluent in this language is very important.

Money Matters Help

You just got your first job and are planning to rent your own apartment. what steps would you follow to make this process easier?

Answers

Explanation:

A Step by Step Guide Through the Rental Application Process

Fill out a rental application. Let's start with the basics: the apartment application itself. ...

Pay the apartment application fee. ...

Expect credit and background checks. ...

Prove you can pay rent. ...

Figure out if you need a co-signer. ...

Show them that you are an agreeable renter. ...

Have good personal references. ...

Sign the lease.

brainliest and follow and thanks

Melissa is creating a speech for her public speaking class. She needs to reference a popular culture trend at her school and it is difficult to
explain with words alone. What type of presentation aid could help her in this situation?

A. Slideshow

B. Whiteboard

C. Video

D. Handout

Answers

A I think would be the best answer. Like a picture or explanation on a slideshow.

Terrance has just signed a contract with a bank to get a loan to buy a new house. What is TRUE about this contract? A. Both the bank and Terrance share power of attorney. B. Terrance has participated in a guarantee of gain. C. Both parties now have an obligation to their agreement. D. Terrance is required to submit a verbal agreement.

Answers

Answer: C. Both parties now have an obligation to their agreement.

Explanation:

When parties get into a contract, they have a legal obligation to each other to fulfill their part of the agreement or the other party will be able to seek redress in a court of law.

Terrance and the bank are now parties to an agreement to provide Terrence with a loan to buy a house. The bank will have to fulfill this obligation by giving Terrence the loan and Terrence will fulfill his side of the agreement by making payments as stipulated in the loan covenant.

why is cost price important in price determination?​

Answers

Answer:

The cost price is the price you buy a product for. You need to compare the cost price to the selling price to know whether you got a profit or loss (did you make money or did you not).

If you don't know the cost price, you don't know whether you have a profit or loss. Of course everyone wants a profit (make money) so to determine a selling price the cost price is important.

answer

The most important factor affecting the price of a product is its cost. ADVERTISEMENTS: Product cost refers to the total of fixed costs, variable costs and semi variable costs incurred during the production, distribution and selling of the product. ... The price for a commodity is determined on the basis of the total cost.

An example of a variable cost is


A) payroll

B) insurance

C) rent

D) labor

Answers

Your answer is Insurance

Answer:

labor

Explanation:

insurance is wrong on edge

On December 31, 2021, Perry Corporation leased equipment to Admiral Company for a five-year period. The annual lease payment, excluding nonlease components, is $40,000. The interest rate for this lease is 10%. The payments are due on December 31 of each year. The first payment was made on December 31, 2021. The normal cash price for this type of equipment is $125,000 while the cost to Perry was $105,000. For the year ended December 31, 2021, by what amount will Perry's earnings increase due to this lease (ignore taxes)

Answers

Answer:

$20,000

Explanation:

Calculation to determine by what amount will Perry's earnings increase due to this lease

Using this formula

Selling price=Fair value-Cost

Let plug in the formula

Selling price=$125,000-$105,000

Selling price=$20,000

Therefore The amount that Perry's earnings will increase due to this lease is $20,000

Which of the following is another name for hard skills?
A. People skills
B. Technical skills
C. Management skills
D. Study skills

Answers

Technical skills is another term that is used to refer to hard skills.

What is meant by technical skills ?

Technical skills are the specialized knowledge and proficiency needed to carry out certain activities and make use of particular equipment and programs in practical settings. Almost every sector and industry, from IT and business administration to health care and education, need a wide range of technical abilities.

Technical skills are specialized knowledge or talents that may be applied to real-world work in the fields of math, science, technology, engineering, and the arts. The use of certain tools and the technology needed to employ those tools are often prerequisites for technical abilities.

Read more on technical skills here:https://brainly.com/question/28146117

#SPJ1

Answer:B. Technical Skills

Explanation:

took the test

When writing a business plan, it
is important to think about the competition. Think of a
product or service you use often. What are the advantages it
has over competing products?

Answers

Depends on the product you are intending on introducing to the public

Say you are developing a phone, what features does it have over Apple? Let’s say Apple released a new feature, the greatest touch screen by average standards, so how can you top that? You can’t cause it’s the “greatest” by average standards

What is the most important information you need to receive a stock quote?

Answers

Answer:

Hello Again!!! (Do you remember me?)

Explanation:

The information that we can get from a stock quote is usually consisting of a bid price, previous bid details, or the total quantity of trade. Generally the stock quote represents the price of share. It usually consists of all previous details of stock that the seller and buyer had finalized before agreeing to final decision.

In a well-diverted portfolio, _______ risk is negligible.

A) Nondiversified
B) Firm-specific
C) Systematic
D) Market

Answers

C systematic risk is negligible

Describe Your action as it applies to the problem
Step 1-define the problem
Step 2-Gather information➡️option 1:,option2
step 3-Evaluate your opinions➡️opinion1:, opinion2:
Step 4- Make a decision
Step 5- implement your decision. Plisss help meeeee

Answers

Answer:

Okay fr go to essay typer

Explanation:

This is fr not a scam it does your paper for you promise

What is an advantage of using credit cards? (Select the best answer.) Credit cards are protected from loss or theft. Credit card accounts can be used as savings accounts. Credit card accounts are always easy to understand. Credit cards have low interest rates.​

Answers

Answer:

The answer is the last one which is credit cards have low interest rate

Explanation:

I think so

Answer:

Credit Cards are protected from loss or theft.

Explanation: THIS IS THE CORRECT ANSWER NOT THE OTHER ONE PEOPLE!

what are the strengths of an entrepreneur​

Answers

Answer:

They're not afraid to take chances

Explanation:

Being an entrepreneur is not for the faint heart but the "if you build it they will come" mentality doesn't always work either. It takes balance of solid planning and research to justify making those leaps of faith

_____ are best described as costs that occur due to political maneuvering by managers to control capital and resource allocation and the resulting inefficiencies stemming from suboptimal allocation of scarce resources.

Answers

Answer:

The Answer is

Explanation:

INFLUNCE COST

How can a budget process help you achieve your life-span goals?

Answers

Answer:

10 ways to achieve your life goals

(1) choose goals that inspire you

(2) be proactive

(3) no more negativity

(4) be balanced

(5) break it down

(6) embrace failure

(7) tell everyone

(8) get help

(9) trace your progress

(10) visualise the end result

A product concept can only graduate to the next phase of the process if it successfully completes the current stage.

True
False

Answers

Answer:

True

Explanation:


Unit 4 Marketing Information Systems Test

Answers

Answer:

bro what tryna say in this question

PLS ANSWER FAST, I'LL GIVE BRAINLIEST

In the healthcare field, there are face-to-face types of jobs and behind-the-scenes jobs. What is the difference between the two? PLEASE give an example of each with your answer.

Answers

Answer:

The answer is below

Explanation:

Face-to-face types of jobs is usually a clinical job that involves the practice or activities of carrying out the diagnosis, treatment, and actual care. For example Physician, Nurse, Surgical Assistant, Medical lab technician, etc.

On the other hand, Behind-the-scenes jobs in the healthcare fields are usually non-clinical jobs, while it may involve interaction with the patients, it does not involve the practice of medical testing or treatments. For example Medical billers and Coders, Transcriptionists, Hospital executives, Receptionists, etc.

The difference between the two is that some doctors meet with the patient and observe their symptoms. Other doctors diagnose what a patient may have by using the knowledge the other doctors provide them with.

Example of a doctor who interacts with the patient face-to-face:

pediatrician

Example of a doctor who works behind the scenes:

Intensevist

While in the planning stage, what would a project manager create through the use of software?
O a proposal for what the project will entail
O a list of goals for the project to meet
O a timeline or schedule for the project
O an evaluation of the project

Answers

an evaluation of the project

In the past, jaleel's vacation time has been spent at home catching a few local attractions when she could afford them. this year, she received a big bonus at work and has decided to finally take the trip to europe that she has always dreamed about. jaleel's purchasing behavior has changed due to_________.


a. the income effect.

b. the substitution effect.

c. cross-price elasticity.

d. the complementary products effect.

e. the substitute products effect.

Answers

Answer:

a. the income effect.

Explanation:

The income effect is the change in demand with respect to the good or service that due to change in the purchasing power of the consumer results in change in real income

Since in the situation it is mentioned that she received a big bonus this year and she decided for a trip to europe so here the purchasing power would be changed due to the income effect

hence, the option a is correct

Sabrina bought a new washing machine. She put $50 down and pays $50 per month for the next 10 months to be able to make the purchase. Which type of credit did she use?

A. an installment sales credit

B. an installment cash credit

C. a single lump-sum credit

D. a bank line of credit

Answers

I’m pretty sure it’s A. I hope this helped!

Sabrina uses an Installment sales credit. Thus the correct answer is A.

What is an installment?

When an individual borrows a fixed amount of money from another person, bank, or financial institution he has to return the borrowed funds in smaller amounts. This smaller amount which is paid by the borrower is referred to as installments.

This installment helps an individual to borrow a big amount of money when needed and allows them to pay in smaller quantities to avoid any financial burden.

In a an installment sales credit, a person is allowed to have Credit sales which is a method for businesses to increase customers' compensation deduction options for a limited time.

In this case when Sabrina bought a new machine. she puts$50 down and Pays $50 per month for the next months reflecting the presence of sales credit.

Therefore, option A an installment sales credit is the appropraite answer.

Learn more about sales credit, here:

https://brainly.com/question/2113592

#SPJ5

I Will give brainliest!!!!!!!!!!!! Now I know this isn't a question for schools, but I figured I really need this answer. A friend and I have a really good idea for a device, but we don't know anything about making machines and coding. How would we get someone who would help us make this idea a reality. I don't mean investors, because then we would still need to make a prototype, I mean find someone with the capabilities of producing our product as well as code it, and so on

Answers

Answer:

post an ad online

Explanation:

or flyers in your city work well to, my friend and i did that and we got a lot of offers

True or False: The parts of the cells called, cellular respiration, glucose and oxygen combine to make carbon dioxide and water releasing energy.

Answers

Answer:

Ture

Explanation:

Answer:

True

hope it helps you have a good day ☺️

PLLZZ HELLLP DUE IN 1 MINNNN
Which list of integers is in order from least to
greatest?
A -42, -39, -4, 40, 41
B -42, 41, 40, -39, -4
C -4, -39, 40, 41, -42
D 41, 40, -4, -39, -42

Feel it all so certainly
I can't stop now, I'm in too deep
And I overtake my senses
And I'll never be in jeopardy
(wave lyrics)

Answers

Answer:

A is the correct answer I think hope this helps

Answer:

A

Explanation:

When the lights dim

And we conquer

You start to feel the pull

I can't help but (help but)

Scream out (scream out)

We're unstoppable

Like a wave

Like a wave (Riding on that energy)

Like a wave (Sifting through the memories)

Like a wave

Riding on that energy

Soaking through the memories

I can't hold back

I'm riding on that energy

Ignite the electricity

Cause you haven't seen the last of me

I'm more than just a memory

Push has just begun to pull

I-I-I can't help but (help but)

Scream out (scream out)

We're unstoppable

Like a wave

Like a wave (Riding on that energy)

Like a wave (Sifting through the memories)

Like a wave

Riding on that energy

Soaking through the memories

I can't hold back

Like a wave

Like a wave (Riding on that energy)

Like a wave (Sifting through the memories)

Like a wave

(I can't hold back)

Like a wave (Riding on that energy)

Like a wave (Sifting through the memories)

I can't hold back

find the area of the squarewhose perimeter is 224cm

Answers

Answer:

3,136

Explanation:

area=3,136 hope that this helps you .I think that's the answer

HELP ITS DUE TODAY!! list things that the government can do to create more employment ​

Answers

Answer:Reduce Interest Rates

Cut Business Payroll Taxes for New Hires

Spend on Unemployment Benefits

Defense Spending and Job Creation  

Explanation:

things that the government can do to create more employment ​

Answer

Reduce Interest Rates Spend on Public Works Spend on Unemployment Benefits Cut Business Payroll Taxes for New Hires Defense Spending and Job Creation When to Use Expansionary Fiscal Policy Job Creation Statistics Presidents Adding Jobs

Which of the following is not an example of an operational cost?

A. the cost of the manufacturing process

B. the cost of supplies

C. the cost of hiring contractors

D. the cost of opening the business

Answers

Answer:

D

Explanation:

Direct expenses are operational expense that can be straightforwardly applied to creating a particular expense object, similar to a decent or administration. Cost objects are things that expenses are alloted to. Instances of direct expenses incorporate direct work, direct materials, and assembling supplies.

Brainliest?

The example of an operating cost does not involve the option d. the cost of opening the business

What are the direct expenses?

It is considered to be the operational expense that should be applied for developing the specific expense object.

An example of the direct expense is direct material, supplies assembling, etc.

Therefore, the option d is correct.

Learn more about cost here: https://brainly.com/question/14084480

4. How do dependent tasks differ from primary tasks? ​

Answers

Answer:

The answer is below

Explanation:

Dependent task is a term used to describe a type of task that is associated with the main or independent task under a particular scope of work. It is usually a sub-task of the whole task that needs to be executed.

On the other hand, a Primary task is a term used to describe a type of task that takes the center stage or the major task with priority. It takes the largest or most resources in its execution.

Other Questions
Is Roddy Rich Dead AKA, Did he die? what is Muscular system In the formula =C5*$B$3, C5 is what type of cell reference?relativeabsolutemixedobscure Please help I will give brainliest can someone please help me with this! Which joint injury is the result of running on hard surfaces or uphill?whiplashrotational injury at shouldershin splintsoveruse of elbow The area of a right triangle is 12 cm2. Which of the following could be the lengths of the legs of the triangle?2 cm and 6 cm4 cm and 6 cm3 cm and 2 cm3 cm and 4 cm What is the value of X in the equation. X- 4.3 = 2.5 Why were Julius and Ethel Rosenberg convicted of treason?They were proven to be spying for the USSR.They tried to attack the US with nuclear weapons.They brought USSR secrets to the US government.They wanted to leave the US to go live in the USSR. Which of the following is a true statement? A. Disruptions in an ecosystem are normal and natural changes.B. Disruptions in an ecosystem are caused by both human activity and environmental disturbances. C. Ecosystems are complex, interactive systems that include both biotic and abiotic components of the environment. D. All of these are true statements. A cylindrical soup can has a radius of 1.1 in. and is 5.4 in. tall. Find the volume of the can and round to the nearest tenths if necessary PLS HELP ASAP WILL MARK BRAINLY!!!. In a bag there are 3 red marbles, 2 yellow marbles and 1 blue marble. After a marble is selected, it is replaced. After 40 attempts at drawing two marbles from the bag, there were three instances where a blue marble then a yellow marble was pulled. What is the experimental probability of pulling a blue marble and then a yellow marble? 0.0556 0.0750 0.0167 0.0333 How do I find the next four of the sequence? Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY