Do I do KFC on this question? If not what do I do??

Do I Do KFC On This Question? If Not What Do I Do??

Answers

Answer 1

Answer:

uh its KCF not KFC, and yes

Step-by-step explanation:

Answer 2
She can cut out 6 pieces btw

Answer: Mc Donalds

Related Questions

help 7th grade math plss

Answers

We’ll call shape 1 the bigger, top triangle, and shape 2 the smaller, bottom triangle.

Formula for area of a triangle is 1/2(base)(height)

For shape 1, the base is 5 and the height is 6.
1/2(5)(6) = 1/2(30) = 15

Shape 2, the base is 4 and the height is 3.
1/2(3)(4) = 1/2(12) = 6

Shape 1 + shape 2 = 15 + 6 = 21.

The units are square feet, because it’s area.

Please let me know if you have any questions.

Answer:

21cm^2

Step-by-step explanation:

1/2 5 x 6 = 15

1/2 x 4 x 3 = 6

15+6 = 21cm^2

If you was working out a missing angle you would 1/2 the longest lines and add them up then add the shortest line

ie) 1/2 6 = 3

1/2 3 5 = 2.5

36+ 25 = 61 sq rt

= 7.81

Then find your multiplier 6/5 =  1.2 you take this multiply by 10

12 and half it = 6 x 7.810 = 46.86 = your angle for the larger triangle.

The smaller triangle missing angle is same method but you keep the multiplier without multiplying by 10 or halfling it, you need to half the 2 sides first then add them to the smaller side found doing Pythagoras and find you r multiplier large side/ second largest side = x  then times x by the multiplier two sides halved and smaller side added. = 3 sq 4 sw = 9+16 = 25 sq = 5 large then + half 4 = 2 + 3

= 2.5+ 2 + 3 = 7.5

then 5/4 = 1.25

=1.25 x 10 = 12.5 then half it = 6.5 then multiply it by 7.5

=6.5 x 7.5 = 48.75 missing angle smaller triangle.

Each of the three oldest children sleeps in a twin bed. They all need bed sheets. A brand of sheets is on sale for “Buy one get one at 50% off”. If each sheet costs $18.00, how much will two sheets cost? How much will six sheets cost? Another brand of sheets is on sale 30% off with a regular price of $18.00 per sheet. Which is a better deal, the previous example or this one? 99$

The three oldest children need shoes. You find a store that has shoes on sale. All shoes in the store are marked $10 per pair. You have a choice of “Three for the price of two” or “Buy one and get 25% off the second.” Which of these is the best deal? Explain your reasoningKatie and Jill currently share a dresser, and each would like to have one of her own. As a valued member at the local furniture store, you receive an additional discount off each purchase. Calculate the amount of discount off each item 20$

The family likes peaches and other fruits. The local farmer’s market is selling fresh peaches at a discounted price. If the farmer’s market sold 35% of its produce and has 280 peaches remaining, how many peaches did it originally have on hand? Show all your work and explain how you used equivalent ratios to solve the problem. 98$

The newborn baby, Jake, needs some supplies. Jake’s mom gave you this list of things he needs. You and your friend have agreed to spend $115 of the $300 on Jake. You spend 15% of it on a new blanket, 25% of it on toys, and 40% of it on clothes. How much money do you have left to spend on diapers for Jake? 115$

You started with $300, and you spent $115 on Jake. You also set aside money to cover the sales tax on $300. Now it’s your turn to decide exactly what you will purchase with the money you have left. You calculated the costs and best prices for sheets, shoes, dressers, and peaches, but you didn’t buy anything yet. Now it’s time to make your purchases. Make a list of the things you will buy and how much each items cost. Explain your purchasing decisions.
the tax is 8.04

plzzzzz help i only need help with the last questionn will give brainliest.

Answers

Answer:

Twin Bed – $60.48

Shoes - $20

Dresser, Mirror, Bookshelf - $82.11

Blanket, Clothes, Toys, Diapers - $277

439.59

i think this is the answer

Please help thanks!!

Answers

The answer you are looking for would be A
Highest
The mean is 24
The mode is 91
The median is 91
Lowest
The modes are 77 and 78
The mean is 477.2857
Median is 77

Ask me if u want me to explain

What is the ratio of the total number of letters to vowels in the word “eleven”?

Answers

Answer:

there is 3 vowels

Step-by-step explanation:

The ratio of the total number of vowels to letters in word eleven is 1:2

What is a ratio?

The quantitative relation between two amounts showing the number of times one value contains or is contained within the other. for example-"the ratio of computers to students is now 2 to 1"

Given here the word eleven where the number of vowels is 3 and total letters is 6

∴ 3:6=1:2

Hence, The ratio of the total number of vowels to letters in word eleven is 1:2

Learn more about ratios here:

https://brainly.com/question/13419413

#SPJ2

What are the names for the parts of a right triangle are choose multiple :
A side 1
B leg b
C side 3
D hypotenuse c
E leg A
F side 2

Answers

Answer:

If a and b are the lengths of the legs of a right triangle and c is the length of the ... So, for example, to square the number 5 you multiply 5 • 5, and to square the number ... In any right triangle, the area of the square drawn from the hypotenuse is ... triangle if you know the length of the triangle's other two sides, called the legs.

I’m trying to figure this out too

7^2 + 2 (\sqrt(81)+ \sqrt(42))

Answers

Answer:

49 + 246 qrst

Step-by-step explanation:

This rectangle and right triangle have the same perimeter.


What is the difference in their areas?


0 square cm

0 square cm

2.0 square cm

2.0 square cm

3.6 square cm

3.6 square cm

4.8 square cm

4.8 square cm

Answers

Answer:

0.18 cm²

Step-by-step explanation:

Given that a rectangle and a triangle have same perimeter . The sides of them are ,

[tex]\begin{cases} Square = 4cm , 4cm , 3cm \ and \ 3cm .\\ Triangle = 4cm , 5.8cm \ and \ 4.2cm \end{cases}[/tex]

We know that area of rectangle is product of length and breadth.

[tex]\implies Area = length \times breadth \\\\\implies Area = 4cm \times 3cm\\\\\implies \red{ Area = 12cm^2}[/tex]

Also we know that the area of triange is half the product of base and height . So that ,

[tex]\implies Area = \dfrac{1}{2}\times 5.8cm \times 4.2 cm \\\\\implies \red{ Area = 12.18 cm^2 }[/tex]

Therefore the difference between them is ,

[tex]\implies D = A_1 - A_1 \\\\\implies D = 12.18cm^2-12cm^2 \\\\\implies \red{D = 0.18 cm^2}[/tex]

Claudia is going to buy a used car for $9,500. She can finance it at the car dealership at 11% interest for 3 years, or she can finance it at the bank at 7% interest for 6 years. What is the difference in interest cost between the car dealer loan and the bank loan?

If she takes the loan from the car dealership, Claudia will have to repay $_____ less in interest than if she took the loan from the bank.

Answers

I’m gonna send you a picture of the one ☝️ I don’t want you to
$9500 ÷ 100 = $95

$95 Is 1%

$95 * 11 = $1045

$1045 * 3 = $3135

——————————

$95 * 7 = $665

$665 * 6 = $3990

——————————

$3990 - $3135 = $855

What conclusion can be drawn from the data in the histogram? Histograms | CK-12 Foundation Question 5 options: Most people sleep 5 hours each night The least amount of people sleep 12 hours each night Seven people sleep 7 hours each night Most people sleep 7 hours each night

Answers

Answer:

I dont know

Step-by-step explanation:

Does anyone wanna be f.r.i.e.n.d.s on brainly???

(also because the question won't go through what 3x3x6x7x8x93x4x4x4 equal?)

Answers

Answer:

yesssssirrrrr and 17998848 is the answer

hope this helps

have a good day :)

Step-by-step explanation:

Answer:

Step-by-step explanation:

17998848 is the answer

Pedro cut a sheet of poster board into 10 equal parts. His brother used some of the poster board and now 7/10 is left. Pedro wants to make a sign from each remaining part of the poster board.



How many signs can he make?

Answers

Answer:

7

Step-by-step explanation:

7 out of 10 is left and Pedro needs a sign from each part left so the remaining which is 7 is used

It would be seven jejrjrjrkrktot


JKL- RST with a scale factor of 1.5

What is tan​

Answers

Answer:

Step-by-step explanation:    

Short answer No They are not congruent. The scale factor would be 1 if they were. JL and RT should both be the same length (they are opposite angles marked with 2 quarter circles). They are not equal. So the scale factor is not 1.

To get from JKL to RST you must multiply every length of JKL by = 20 / 25 or 4/5. So 15 * 4/5 = 12 which works. 4/5 * 20 = 16 which also works.

The two triangles are similar.

I don’t want any links in here I just want you guys to answer it with shown work

Answers

Answer:

the answer is A.

Step-by-step explanation:

After multiplying the two fractions: [tex]\frac{-7}{4} * \frac{5}{3} = \frac{-35}{12} = -2\frac{11}{12}[/tex]

You might also want to consider that it's negative because it's BELOW sea level. If you are going down, that wount mean that it is negative. So after mltiplying and turning the result into a proper fraction, you get A as your final answer.

Answer:

-2 11/12 is correct as 12/12 + 12/12 + 11/12 = -35/12 so answer is converted to -2 11/12

50 Points
Start at the origin. Move 5 units right and 10 units up. What is the ordered pair at this point?
Answers:
a
(5, 5)
b
(5, 1)
c
(5, 10)
d
(10. 5)

Answers

the answer is C because it moves 5 right and 10 up so it’s still positive on both 5 is x and 10 is y

Can you help me and just dont answer if you dont know

Answers

Answer:

I answered two.

Step-by-step explanation:

make a frequency table to organize the data

Answers

Answer: to do that you would use slop x2- x1

-------- = rise/run = slope

Y2-x1

Step-by-step explanation:

Plz help ASAP thxs."..

Answers

Answer: A625 in.³

Step-by-step explanation: check work provided down below!!

Handing out Brainliest! Help out whenever you can ^-^

Consider Carmen’s plans.

What is the value of x?
A. x = 5
B. x = 9
C. x = 13
D. x = 16

Answers

Answer:

the answer is 9

Step-by-step explanation:

Answer:

B. X=9

Step-by-step explanation:

hope this helped:)

Find the area of the triangle.



The area is_________
square meters.

Answers

Answer:

48msquare

Step-by-step explanation:

Area of triangle = 1/2 x b x h

1/2 x 12 x 8

Answer:

48m²

Step-by-step explanation:

8 times 12 divided by 2

:p help............::

Answers

Answer:  i think it is b

Step-by-step explanation: the second option

Answer:

-12 is your Answer

Step-by-step explanation:

pls ,ark brainliest if right

The intersection of two sides of an angle is called its what?

Answers

it is called the vertex
The point where the Ray's intersect is called the vertex of the angle. The two rays are called the sides of the angle.

An 8-foot-long piece of wood is cut into 3 equal pieces. How many inches long is each piece of wood?

3.2 inches
32 inches
320 inches
3,200 inches

Answers

8 x 12 = 96 so then 96 divided by 3 is your answer which is 32. 32 inches is your answer!
32 inches because 8x12=96 and 96 divided by 3 equals 32

NEEDED ASAP! Show your work. Will mark brainliest!

Answers

Answer:

32 degrees

Step-by-step explanation:

Because the triangle is isosceles, 2 of its angles must equal each other:

15x - 31 = 9x + 11

---> x = 7

Plug 7 into either 15x - 31 and 9x + 11:

15(7) - 31 = 74 degrees

and

9(7) + 11 = 74 degrees

Add them together, and you get 148 degrees.

Finally, subtract 180 from 148 to get 32 degrees for angle S.

NAHAHAGAHAHAHAUAHAHAHSIISKSJWJSJS

You've flipped the coin 3 times, and it has come up heads once. The cumulative fraction of heads is currently 1/3. If you flip the coin once more time, will it land heads up to make the cumulative fraction 2/4?

Answers

Answer:

Maybe. Either 2/4 or 1/4.

Step-by-step explanation:

If you flip a coin 100 times, ABOUT 50 percent will be heads up. Therefore it's not unlikely it up land heads up 2 out of 4 times, but its not unlikely it will be heads down either.

What is the slope of (8,8) and (8, -3)?

Answers

11/0
explanation: I’m working on slopes and this was one of my math problems

io have another hard question?
hope. thats it.

Answers

I can’t see the question tho

71%!! almost to 80%! thank you so much fnej!
marking brainlest when i answer questions later on!
please help anybody! shoutout to
brainly.com/app/profile/19154158/answers

Answers

Answer:

Start

Step-by-step explanation:

The measure of spread is the variation so we can use range:

Range of Start:

15 - 7 = 8

Range of End:

13 - 6 = 7

Start had a bigger value so it had the greater variation

Can u plss help (plss no links)

Answers

Answer:

24 and 8

Step-by-step explanation:

range=64-40=24

interquartile=50-42=8

Helping the other person get brainliest. Dont mind my response.

It costs a company $2 to make a pizza. They added $1.50 to the price and sold them for $3.50. What was the percent of mark-up?

Answers

i think that the answer is 75% extra

write any value that is a solution of inequality 2x+1≥11.

Answers

Answer:

x ≥ 5

Step-by-step explanation:

2x+1≥11

2x + 1 - 1 ≥ 11 - 1

2x ≥ 10

2x/2 ≥ 10/2

x ≥ 5

Any value of x that is greater than or equal to 5 will be a solution of the inequality 2x + 1 ≥ 11. ( x = 5, x = 6, x = 10, etc. )

What is the solution to the inequality?

Given the inequality in the question:

2x + 1 ≥ 11

To find a value that is a solution of the inequality 2x + 1 ≥ 11, we need to find a number for x that makes the inequality true.

2x + 1 ≥ 11

Isolate the variable term by subtracting 1 from both sides of the inequality:

2x + 1 - 1 ≥ 11 - 1

2x ≥ 11 - 1

2x ≥ 10

Next, divide both sides by 2 to solve for x:

2x/2 ≥ 10/2

x ≥ 10/2

x ≥ 5

Therefore, the value that is a solution can be any number greater than or equal to 5.

Learn more about inequality here: https://brainly.com/question/30231017

#SPJ2

Other Questions
Which joint injury is the result of running on hard surfaces or uphill?whiplashrotational injury at shouldershin splintsoveruse of elbow The area of a right triangle is 12 cm2. Which of the following could be the lengths of the legs of the triangle?2 cm and 6 cm4 cm and 6 cm3 cm and 2 cm3 cm and 4 cm What is the value of X in the equation. X- 4.3 = 2.5 Why were Julius and Ethel Rosenberg convicted of treason?They were proven to be spying for the USSR.They tried to attack the US with nuclear weapons.They brought USSR secrets to the US government.They wanted to leave the US to go live in the USSR. Which of the following is a true statement? A. Disruptions in an ecosystem are normal and natural changes.B. Disruptions in an ecosystem are caused by both human activity and environmental disturbances. C. Ecosystems are complex, interactive systems that include both biotic and abiotic components of the environment. D. All of these are true statements. A cylindrical soup can has a radius of 1.1 in. and is 5.4 in. tall. Find the volume of the can and round to the nearest tenths if necessary PLS HELP ASAP WILL MARK BRAINLY!!!. In a bag there are 3 red marbles, 2 yellow marbles and 1 blue marble. After a marble is selected, it is replaced. After 40 attempts at drawing two marbles from the bag, there were three instances where a blue marble then a yellow marble was pulled. What is the experimental probability of pulling a blue marble and then a yellow marble? 0.0556 0.0750 0.0167 0.0333 How do I find the next four of the sequence? Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY Which equation can be used to solve for x in the following diagram?150102 Marcys breakfast table has a square table top with an area of 36 square feet. What is the approximate diagonal length of the table top? Round to the nearest tenth. Figure out length in inches for brainiest and 5 stars. ZABD and ZDBC are supplementary angles.What is the measure of x?x = [?]7DAT110%B>CAngles are not drawn to scale.Enter The number of blueberry muffins made is 40% of the total number of total muffins they make daily. On tueday, the baker makes 60 muffins. How many miffins does the Baker bakes on Tuesday?