Convert 0.809 mol AlCl3 to formula units AlCl3.

Answers

Answer 1

Answer:

133.340538.

Explanation:

The answer is 133.340538. We assume you are converting between grams AlCl3 and mole. You can view more details on each measurement unit: molecular weight of AlCl3 or mol This compound is also known as Aluminium Chloride. The SI base unit for amount of substance is the mole.


Related Questions

Please give me the answer please

Answers

Answer:

A. 30cm³

Explanation:

Based on the chemical reaction:

CaCO₃ + 2HCl → CaCl₂ + H₂O + CO₂

1 mol of calcium carbonate reacts with 2 moles of HCl to produce 1 mol of CO₂

To solve this question we must convert the mass of each reactant to moles. With the moles we can find limiting reactant and the moles of CO₂ produced. Using PV = nRT we can find the volume of the gas:

Moles CaCO₃ -Molar mass: 100.09g/mol-

1.00g * (1mol / 100.09g) = 9.991x10⁻³ moles

Moles HCl:

50cm³ = 0.0500dm³ * (0.05 mol / dm³) = 2.5x10⁻³ moles

For a complete reaction of 2.5x10⁻³ moles HCl there are necessaries:

2.5x10⁻³ moles HCl * (1mol CaCO₃ / 2mol HCl) = 1.25x10⁻³ moles CaCO₃. As there are 9.991x10⁻³ moles, HCl is limiting reactant.

The moles produced of CO₂ are:

2.5x10⁻³ moles HCl * (1mol CO₂ / 2mol HCl) = 1.25x10⁻³ moles CO₂

Using PV = nRT

Where P is pressure = 1atm assuming STP

V volume in L

n moles = 1.25x10⁻³ moles CO₂

R gas constant = 0.082atmL/molK

T = 273.15K at STP

V = nRT / P

1.25x10⁻³ moles * 0.082atmL/molK*273.15K / 1atm = V

0.028L = V

28cm³ = V

As 28cm³ ≈ 30cm³

Right option is:

A. 30cm³

A company claims that its weight-loss product is the safest. Why might this
be a biased claim?
A. The company is trying to get you to buy its product.
B. The company has lots of scientific information about the product
C. The company is very successful.
D. The company has studied the product more than anyone.​

Answers

The answer could either be C or A.

atoms and ions are held together by..
A.) nuclear bonds
B.) Stick bonds
C.) physical bonds
D.) Chemical bonds

Answers

Answer:

chemical bonds

Explanation:

The atoms in chemical compounds are held together by attractive electrostatic interactions known as chemical bonds. Ionic compounds contain positively and negatively charged ions in a ratio that results in an overall charge of zero. The ions are held together in a regular spatial arrangement by electrostatic forces.

A 31.0 mL sample of 0.624M perchloric acid is titrated with a 0.258M sodium hydroxide solution.

What is the (H+) molarity after the addition of 15.0 mL of KOH?

Answers

Answer:

0.0922 M

Explanation:

The problem first states that the titration is made using NaOH, and later asks about the addition of KOH. I'm going to assume NaOH was used throughout the whole problem. The result does not change if it was KOH instead.

The reaction that takes place is:

HClO₄ + NaOH → NaClO₄ + H₂O

First we calculate how many HClO₄ moles are there in the sample, using the given molarity and volume:

0.624 M * 13.0 mL = 8.11 mmol HClO₄

Then we calculate how many NaOH moles were added:

0.258 M * 15.0 mL = 3.87 mmol NaOH

Now we calculate how many HClO₄ remained after the reaction:

8.11 - 3.87 = 4.24 mmol HClO₄

As HClO₄ is a strong acid, 4.24 mmol HClO₄ = 4.24 mmol H⁺

Finally we calculate the molarity of H⁺, using the calculated number of moles and final volume:

Final volume = 31.0 mL + 15.0 mL = 46.0 mL4.24 mmol / 46.0 mL = 0.0922 M

Can someone help me please

Answers

Answer: The pH of the substance is 8.25. The solution is basic.

Explanation:

pH or pOH is the measure of acidity or alkalinity of a solution.

pH is calculated by taking negative logarithm of hydronium ion concentration. The acids have pH ranging from 1 to 6.9 , salts have pH of 7 and bases have pH ranging from 7.1 to 14.

[tex]pH=-\log [H_3O^+][/tex]  

Putting in the values:

[tex]pH=-\log[5.6\times 10^{-9}][/tex]

[tex]pH=8.25[/tex]

Thus as pH is more than 7, the solution is basic.

The pH of the substance is 8.25. The solution is basic.

If the reaction is begun with an initial PH3 concentration of 0.95 M, what will be the concentration of PH3 after 30.50 s

Answers

Answer:

[tex][PH_3]=0.30M[/tex] but see detailed explanation, please.

Explanation:

Hello there!

In this case, unfortunately, we are not given the rate constant but we can set up a reaction according to the information available on the internet:

[tex]4PH_3\rightarrow P_4+6H_2[/tex]

Whose rate constant is 0.0375/s. In such a way, it is possible infer that this is first-order reaction whose integrated rate law is:

[tex][PH_3]=[PH_3]_0exp(-kt)[/tex]

Thus, given the initial concentration, rate constant and elapsed time, the final concentration of PH3 would be:

[tex][PH_3]=(0.95M)exp(-30.50s*0.0375/s)\\\\[/tex]

[tex][PH_3]=0.30M[/tex]

However, it is important to keep in mind this result may vary according to your actual question.

Regards!

Which soil horizon contains the most organic matter?

A horizon
B horizon
C horizon
D horizon

Answers

Answer:

I- It says horizon so.....what....wth ._.

Explanation:

An unknown aqueous metal analysis yielded a detector response of 0.255. When 1.00 mL of a solution containing 100.0 ppm of the metal was mixed with 99.0 mL of the unknown, the detector signal increased to 0.502. Calculate the concentration of the metal in the unknown solution. Report your answer in ppm

Answers

Answer:

1.022ppm is the unknown concentration of the metal

Explanation:

Based on Lambert-Beer law, the increasing in signal of a detector is directly proportional to its concentration.

The unknown concentration (X) produces a signal of 0.255

99mL * X + 1mL * 100ppm / 100mL produces a signal of 0.502

0.99X + 1ppm produce 0.502, thus, X is:

0.255 * (0.99X + 1 / 0.502) =

X = 0.503X + 0.508

0.497X = 0.508

X =

1.022ppm is the unknown concentration of the metal


A scientist has two substances that she is testing in her lab: a pink
substance and a green substance. At room temperature, both substances
are liquids. The scientist transferred the same amount of energy into both
substances. She finds only the pink substance changed phase. How is the
pink substance different from the green substance? The pink substance
has a...

1) weaker attraction between its molecules than the green substance. Its molecules now
move away from each other.
2) weaker attraction between its molecules than the green substance. Its molecules now
move in place.
3) stronger attraction between its molecules than the green substance. Its molecules
now move away from each other.
4) stronger attraction between its molecules than the green substance. Its molecules
move around each other.

Answers

Answer:

1

Explanation:

........................


1. This is very important in preventing the spread of pathogens in the kitchen.

Answers

Sanitising is very important in a house hold but most importantly in the kitchen we have to always keep things clean and sanitise for the sake of our health and the people around us

Explain using balanced chemical equations, the alkaline hydrolysis reaction of esters. ​

Answers

Answer:

The alkaline hydrolysis of ester is known as saponification. When ester is heated with aqueous NaOH, sodium salt of acid and alcohol are formed.

The process of saponification of an ester in an alkaline solution. Alcohol and sodium salt of acid are created when the bis heated with aqueous NaOH.

What is saponification ?

Esters are converted into soap and alcohol through the process of saponification, which uses an aqueous alkali. Fatty acids, which are long-chain carboxylic acids, are the building blocks of soaps. Sodium stearate is a regular soap ingredient.

From the Latin sapo, which signifies soap, the reaction is known as a saponification. The term is derived from the fact that fats were once hydrolyzed into esters to produce soap.

Particularly in the food industry, saponification is significant because it makes it simpler to estimate the amount of free fatty acids present in a specific food product. The quantity of free fatty acid can be determined by measuring how much alkali was needed to neutralize the fat or oil.

Thus,the alkaline hydrolysis reaction of esters is called as saponification.

To learn more about saponification, follow the link;

https://brainly.com/question/16495580

#SPJ2

Write the chemical equation for the dissolution of NH4Cl in water including the
Heat term

Answers

NH4Cl—-H2O—-> NH4+Cl
Heat=14.78 kj

What is the benefit of adding sodium hydroxide and sulfuric acid?

Answers

Answer:

When sodium hydroxide react with sulphuric acid they form Sodium sulphate and water. The reactants is base and an acid, which leads to neutralization process and yields a salt .

Answered by The One and only #Queen

Are based on the intrinsic properties of the chemical

Answers

Answer:

In materials science, an intrinsic property is independent of how much of a material is present and is independent of the form of the material, e.g., one large piece or a collection of small particles. Intrinsic properties are dependent mainly on the fundamental chemical composition and structure of the material.

Explanation:

mark as brainliest

HELP ME PLSSSSSSSSSSSSAA

Answers

Answer:

If capital R is round, than the RR and Rr will mean round, and the two rr's are wrinkled. that means the answer to both is 50%

Explanation:

hope that helps

Graphite and diamond are both solid forms of the element carbon. Which statement explains
the different properties of these two forms of carbon?
(1) Diamond has ionic bonding and graphite has metallic bonding.
(2) Diamond has metallic bonding and graphite has ionic bonding.
(3) Diamond has a different crystal structure from graphite.
(4) Diamond has carbon atoms with more valence electrons than graphite.

Answers

Answer: C diamond has a different crystal structure from graphite

Explanation:

The difference between the properties of  two forms of carbon is that

Diamond has a crystal structure  different from graphite.

Graphite and Diamond are known as allotropes of Carbon as they have the

same chemical properties but different crystal structure.

Diamonds form a 3 crystal lattice with no flexibility while Graphite are

bonded to sheets which makes them slide easily within one another and

gives it its soft texture.

Read more on https://brainly.com/question/23491824

(ONLY ANSWER IF U R SURE PLZ) A scientist is performing a fermentation of bioethanol and the current pH is roughly 6.5. What should the scientist do to get the pH to the optimum value of 5.0?


A. Increase the temperature, which will lower the pH.

B. Add an appropriate amount of acetic acid.

C. Adjust the airflow to allow more oxidation.

D. Add an appropriate amount of sodium hydroxide.

Answers

D. Add an appropriate amount of sodium hydroxide.

Usually, chemical processes require an optimum pH. This is the pH at which the desired chemical conversion gives  the maximum yield.

As we can see, the pH of the system is much higher than the optimum pH. We can decrease the pH to the optimum pH of 5.0 by adding an appropriate amount of  a base such as NaOH.

Hence, the pH can be brought to 5.0 from 6.5 by adding an appropriate amount of NaOH.

https://brainly.com/question/15255706

8.8 Why do esters with higher molecular mass not have strong fragrances?​

Answers

Answer:

Basically, fragrances reach other person through sense of smell. So, the strength of the fragrances depends a lot on its evaporation, which is strongly related to the boiling point. Esters with higher molecular weight do not have a strong fragrance because it has a higher boiling point.

a 61601609060
in word​

Answers

61601609060 in a word

PLEASE HELP WILL MARK BRAINLEST!!!

Answers

Answer:

I think its 3.6 to the right

Explanation:

I apologize if im wrong

Many scientists think human cloning is possible, so why haven't we made human clones yet?

Question 5 options:

There is not enough medical supplies to clone a human


Human cloning is extremely controversial and many people believe it is unethical


Scientists have determined that stem cells would not be beneficial to human cloning


The human genome is too complex to clone

Answers

Answer:

GIVEN IT'S A MULTI CHOICE QUESTION:

1. False

2. True

3. False

4. True

IF ITS NOT

2

Explanation:

We haven't made human clones because human cloning is extremely controversial and many people believe it is unethical.

What is cloning?

Cloning is a genetic technique that can be used to reproduce genetically identical organisms in a laboratory.

Human cloning refers to the generation of genetically identical humans in the laboratory.

Human cloning can be considered unethical because a person has the right to have an identity, and the cloning technique faces this principle.

In conclusion, we haven't made human clones because human cloning is extremely controversial and many people believe it is unethical.

Learn more in:

https://brainly.com/question/4736686

PLEASE HELP ME ON THIS QUESTION

Answers

he call me big purr

How can radioisotopes help in promoting clean technology in the mitigation of the effect of climate change? What are the challenges in the application of this technology?​

Answers

Forget about mitigating climate change. Our planet has been warming nicely for the last three hundred years or more, and is a lot more productive and comfortable to live on than it was back then. All we have to do is not stuff it up.

HOPE IT HELPS U

FOLLOW MY ACCOUNT PLS PLS

Which of these objectives do you feel like you've accomplished so far?

Answers

In order to determine the objectives that you've accomplished, you should identify the steps required to test a hypothesis.

What is a scientific method?

A scientific method refers to the various techniques and objectives that are adopted to observe, investigate, and study the natural world while giving explanations on the basis of the evidence, hypothesis, or factual information that are derived from a research work.

The steps of a scientific method.

An effective and efficient way to accomplish your objectives during a research work include the following:

Make observations.Ask questions.Construct a hypothesis.Test the hypothesis with an investigation.Analyze the data.Explain the result.Communicate the result.

In conclusion, you should identify the steps required to test a hypothesis in order to determine the objectives that you've accomplished.

Read more on scientific method here: brainly.com/question/17216882

2C10H22 + 3102
20CO2 + 22H2O
What mass of O2 is needed to react completely with 7.5 grams of C10H22?

Answers

Answer:

2c11h21

Explanation:

Environments have changed over millions of years. Which of these would be best for a scientist to study when investigating these environmental changes?


A. volcanic deposits

B. weather forecasts

C. fossil records

D. ocean currents (There is no science subject so ima put mathematics)

Answers

Don’t press the file might have cookies or virus

Answer:

c

Explanation:

fossil records

Without using the value of So, predict the sign for
a) 2K(s) + F2(g) → 2KF(g)
b) NaClO3(s) → Na+(aq) + ClO3-(aq)
c) 2NO(g) + O2(g) → 2NO2(g)
d) H2S(g) + O2(g) → S8(s) + H2O(g)

Answers

Answer:

a) 2f

B)CIO3+na

c)2NO2(g)

d)HSO3(h)

Explanation:

The sign of entropy depends on the number of gaseous substance in the system. In the first reaction, the number of gaseous particles increase in the product hence, randomness increases and thereby entropy is positive.

What is entropy ?

Entropy is a thermodynamic quantity which measures the randomness of the system. As the disorder in the system increases, the entropy increases and the entropy change is said to be positive in sign.

In the first reaction, in the product side, 2 moles of gaseous substance is formed, which increases the randomness, hence, entropy change is positive.

In the second reaction, the more ordered solid state is getting into less ordered aqueous state. Hence, S is positive.

For the third reaction, the number of moles of gas decreases from 3 to 2. Hence S is negative. For the last reaction, there is no change in number of moles or state of substance and no change in S.

Find more on entropy:

https://brainly.com/question/13135498

#SPJ3

A substance has a percent composition of 17.55% Sodium, 39.70%
Chromium, and 42.75% Oxygen. What is the empirical formula of the
substance? *

Need help anyone plz :)

Answers

Cr2Na2O7

Sodium Dichromate

1. In apothecaries' measures: 1 scruple = 20 grains, 1 ounce = 480 grains, 1 oz = 28.34 g
What is the mass in micrograms of 5.00 scruples? Remember the known and the
unknown?!

Answers

Answer:

5.89 g × 10⁶ μg

Explanation:

Step 1: Convert 5.00 scruples to grains

We will use the conversion factor 1 scruple = 20 grains.

5.00 scruple × 20 grain/1 scruple = 100 grain

Step 2: Convert 100 grains to ounces

We will use the conversion factor 1 oz = 480 grains.

100 grain × 1 oz/480 grain = 0.208 oz

Step 3: Convert 0.208 oz to grams

We will use the conversion factor 1 oz = 28.34 g.

0.208 oz × 28.34 g/1 oz = 5.89 g

Step 4: Convert 5.89 g to micrograms

We will use the conversion factor 1 g = 10⁶ μg.

5.89 g × 10⁶ μg/1 g = 5.89 g × 10⁶ μg

The mass in micrograms of 5 scruples is 5.9×10⁶ μg

We'll begin by converting 5 scruples to grains.

1 scruple = 20 grains

Therefore,

5 scruples = 5 × 20

5 scruples = 100 grains

Next, we shall convert 100 grains to grams

480 grains = 1 ounce

But

1 ounce = 28.34 g

Thus, we can say that

480 drains = 28.34 g

Therefore,

100 grains = (100 × 28.34) / 480

100 grains = 5.9 grams

Finally, we shall convert 5.9 grams to micro grams

1 g = 1×10⁶ μg

Therefore,

5.9 g = 5.9 × 1×10⁶ μg

5.9 g = 5.9×10⁶ μg

Therefore, 5 scruples is equivalent to 5.9×10⁶ μg

Learn more: https://brainly.com/question/25008909

Who first proposed the concept of free energy?
a. Gibbs
b. Lavoisier
c. Dalton
d. Hess

Answers

Answer:

Hello There!!

Explanation:

The answer is=>a. Gibbs.

hope this helps,have a great day!!

~Pinky~

[tex]\huge{\textbf{\textsf{{\color{navy}{An}}{\purple{sw}}{\pink{er}} {\color{pink}{:}}}}}[/tex]

a. Gibbs

Thanks
Other Questions
Which joint injury is the result of running on hard surfaces or uphill?whiplashrotational injury at shouldershin splintsoveruse of elbow The area of a right triangle is 12 cm2. Which of the following could be the lengths of the legs of the triangle?2 cm and 6 cm4 cm and 6 cm3 cm and 2 cm3 cm and 4 cm What is the value of X in the equation. X- 4.3 = 2.5 Why were Julius and Ethel Rosenberg convicted of treason?They were proven to be spying for the USSR.They tried to attack the US with nuclear weapons.They brought USSR secrets to the US government.They wanted to leave the US to go live in the USSR. Which of the following is a true statement? A. Disruptions in an ecosystem are normal and natural changes.B. Disruptions in an ecosystem are caused by both human activity and environmental disturbances. C. Ecosystems are complex, interactive systems that include both biotic and abiotic components of the environment. D. All of these are true statements. A cylindrical soup can has a radius of 1.1 in. and is 5.4 in. tall. Find the volume of the can and round to the nearest tenths if necessary PLS HELP ASAP WILL MARK BRAINLY!!!. In a bag there are 3 red marbles, 2 yellow marbles and 1 blue marble. After a marble is selected, it is replaced. After 40 attempts at drawing two marbles from the bag, there were three instances where a blue marble then a yellow marble was pulled. What is the experimental probability of pulling a blue marble and then a yellow marble? 0.0556 0.0750 0.0167 0.0333 How do I find the next four of the sequence? Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY Which equation can be used to solve for x in the following diagram?150102 Marcys breakfast table has a square table top with an area of 36 square feet. What is the approximate diagonal length of the table top? Round to the nearest tenth. Figure out length in inches for brainiest and 5 stars. ZABD and ZDBC are supplementary angles.What is the measure of x?x = [?]7DAT110%B>CAngles are not drawn to scale.Enter The number of blueberry muffins made is 40% of the total number of total muffins they make daily. On tueday, the baker makes 60 muffins. How many miffins does the Baker bakes on Tuesday?