Roy made a pizza that is 12 inches in diameter. He knows he can eat about 84. 8 in, at what angle should Roy cut the pizza in radians? Round your answer to the tenths place

Answers

Answer 1

Roy should cut the pizza at an angle of 4.7 radians if the total diameter of the pizza is 12 inches.

Diameter of the pizza = 12 inches

The area he can eat = 84. 8 inches

The area of the pizza for 12 inches diameter can be calculated by using the formula:

Area = π*[tex]r^2[/tex]

Area = π* ([tex]6^2[/tex])

Area = 36π

The angle of the slice of pizza he can eat about 84.8 square inches can be calculated as:

Area of sector = (θ/2) ×[tex]r^2[/tex]

84.8 = (θ/2) × [tex]6^2[/tex]

84.8 = 18*θ

θ = 84.8 / 18

θ = 4.71 radians

Therefore, we can conclude that Roy should cut the pizza at an angle of  4.7 radians.

To learn more about Radians

https://brainly.com/question/7721249

#SPJ4


Related Questions

F(x)= x⁴ +14x²+45 (100 points)

for this function: state the number of complex zeros, the possible number of imaginary zeros, the possible number of positive and negative zeros, and the possible rational zeros

then factor to linear factors and find all zeros


-number of complex zeros: ___________________

-possible # of imaginary zeros: ______________________

-possible # of positive real zeros: _____________________

-possible # negative real zeros: __________________

-possible rational zeros: ___________________

-factors to: _________________________

-zeros: ______________________

Answers

For the function,

-number of complex zeros: four

-possible # of imaginary zeros: two pairs

-possible # of positive real zeros: zero

-possible # negative real zeros: 0 or 2

-possible rational zeros:  ±1, ±3, ±5, ±9, ±15, ±45

-factors to: (x + 3i)(x - 3i)(x + √5i)(x - √5i)

-zeros: x = ±3i, x = ±√5i.

The function is: F(x) = x⁴ +14x²+45.

Number of complex zeros: By the Fundamental Theorem of Algebra, the function has at most four complex zeros.

Possible number of imaginary zeros: If the complex zeros are not real, then there are at most two pairs of imaginary zeros.

Possible number of positive real zeros: The function has no positive real zeros since F(x) is always positive for x>0.

Possible number of negative real zeros: By Descartes' Rule of Signs, the function has either 0 or 2 negative real zeros.

Possible rational zeros: The rational zeros can be found using the Rational Root Theorem. They are of the form ±(a factor of 45) / (a factor of 1), which gives the following possible rational zeros: ±1, ±3, ±5, ±9, ±15, ±45.

To factor the polynomial:

F(x) = x⁴ +14x²+45

= (x² + 9)(x² + 5)

So the factors to linear factors are: (x + 3i)(x - 3i)(x + √5i)(x - √5i), where i is the imaginary unit.

Therefore, the zeros are: x = ±3i, x = ±√5i.

Note that all zeros are complex since there are no real roots.

To know more about function, refer to the link below:

https://brainly.com/question/30076565#

#SPJ11

Question content area top Part 1 Point B has coordinates ​(3​,2​). The​ x-coordinate of point A is −9. The distance between point A and point B is 15 units. What are the possible coordinates of point​ A

Answers

The possible coordinates of point A are (-9, -7) and (-9, 11).

What are coordinates?

Coordinates refers to a set of numbers that are used to identify the position of a point in a space, usually defined by an x-axis, y-axis, and in sometimes a z-axis.

Let the y-coordinate of point A be y. Then the coordinates of point A are (-9, y).

Using the distance formula, we have:

√[(3 - (-9))² + (2 - y)²] = 15

Simplify the equation:

√[(12)² + (2 - y)² = 15

Square both sides of the equation, we get:

(12)² + (2 - y)² = 15²

144 + (2 - y)² = 225

(2 - y)² = 225 - 144

(2 - y)² = 81

We now take the square root of both sides:

2 - y = ±9

Solve for y in each case, we get:

y = 2 - 9 = -7 or y = 2 + 9 = 11

Therefore, the possible coordinates of point A are (-9, -7) and (-9, 11).

Learn more about coordinates of point at brainly.com/question/31293074

#SPJ1

URGENTEEEE!! REPONDER RAPIDO POR FAVOR!!!

Which of the following could be the graph of f(x)=(2/5)^x?

Answers

Answer:

The third graph from the top could be the graph of f(x) = (2/5)^x. As x approaches infinity, f(x) approaches 0.

1. What are the current health issues and concerns in your community?

2. If you are a health worker in your community,what health issues and concerns do you think should be addressed immediately?why?
3. What will the world be like if health issues and concerns are not properly addressed by people around the world?

HELPPPPP PO

Answers

Infectious diseases, chronic conditions, mental health, healthcare access, health disparities. Vaccination campaigns, disease prevention, healthcare access, mental health support, social determinants. Increased disease burden, higher costs, reduced quality of life, higher mortality, strained healthcare systems, hindered socio-economic development.

What are the current health issues and concerns in your community? The current health issues and concerns in the community include a range of factors such as infectious diseases, chronic conditions, mental health challenges, healthcare access and affordability, health disparities, and the impact of lifestyle choices on overall well-being. As a health worker in the community, immediate attention should be given to addressing issues such as promoting vaccination campaigns, disease prevention and control measures, improving healthcare access and affordability, advocating for mental health support and awareness, and addressing social determinants of health. If health issues and concerns are not properly addressed globally, the consequences could be severe. There would likely be increased prevalence of diseases, higher healthcare costs, reduced quality of life, higher mortality rates, and widening health inequalities.

Learn more about mental health support

brainly.com/question/28100742

#SPJ11

What is the perimeter of triangle abc? round answers to the nearest tenth.
a
145°
6 m
45°
b
oa.
20.5 meters
ob.
b. 22.4 meters
oc.
12 meters
od.
18 meters

Answers

The Perimeter of the Triangle is 20.5. when the AB value is 6 m and the angles are 45°. Option B is the correct answer

Given:

AB = 6 m

∠ACB = 45°

By using Trigonometry formulas,

We can determine the AC length by using the sin 45° formula and it is given as,

sin 45° = opposite / hypothesis

sin 45° = AB /AC

1/√2 = 6/ AC

AC = 6√2

We can determine the BC length by using the tan 45° formula which is given as,

tan 45° = opposite / adjacent

tan 45° =AB/ BC

1 = 6/ BC

BC= 6

Now we can determine the perimeter of the triangle by using the perimeter of the triangle formula which is given as,

[tex]P=a+b+√a²+b²[/tex]

Where:

a = opposite side = AC

b = adjacent side = BC

Substuting the a and b values in the above equation we get,

= 6 + 6 +√ 6²+ 6²

= 6 + 6 + 6√2

= 12 +6√2

= 6(2 + √2)

= 20.48 ≅ 20.5

Therefore, The perimeter of the triangle ABC is 20.5.

To learn more perimeter of the triangle:

https://brainly.com/question/29244577

#SPJ4

I need help finding the decimal for these equations.

Answers

Answer:

Carlos=1.5041

Mykala=2.6991

William=4.1350

Emily=4.1773

Alice gardener wants to build a rectangular enclosure with a dividing fence in the middle of the rectangle. On one side, she plans to put some goats, on the other side she wants to raise some vegetables. The fence along the outside of the rectangle costs $3 per foot, but the dividing fence costs $12 per foot.



(a) Alice decides to spend $240 on the fencing, what is the maximum area she can enclose? Justify your answer.



(b) If Alice decided she wants to enclose 300 square feet, what is the minimum cost?

Answers

Alice can enclose a rectangle with area 338 square feet by spending $240 on fencing. The minimum cost to enclose 300 square feet is $476.64.

Let's suppose that the rectangle is x feet wide, so its length is 2x. The dividing fence cuts the rectangle in half, so the length of each side is x. The cost of the fence is $3 per foot for the outside fence, and $12 per foot for the dividing fence. Alice has $240 to spend, so

$3(2x) + $12(x) = $240

Solving for x, we get

6x + 12x = 240

18x = 240

x = 13.33

Since x has to be a whole number, we can use 13 as the width. The length is 2x, or 26 feet. The area of the rectangle is

13 x 26 = 338 square feet

If Alice wants to enclose 300 square feet, we know that the area of the rectangle is

Area = width x length

Since the rectangle is divided in half by the dividing fence, the length of each side is half the total length, or x. So

Area = x²

We can rearrange this to solve for x

x² = 300

x = √(300) = 17.32 (rounded to two decimal places)

Since the width of the rectangle is half the length, the width is:

Width = 17.32 / 2 = 8.66 (rounded to two decimal places)

The total length is twice the width, or 17.32. The perimeter of the rectangle is

2(8.66 + 17.32) = 52.96 feet

The cost of the outside fence is $3 per foot, so the cost of the outside fence is

$3(52.96) = $158.88

The dividing fence is in the middle of the rectangle, so the length is half the perimeter, or 26.48 feet. The cost of the dividing fence is $12 per foot, so the cost is

$12(26.48) = $317.76

The total cost is the sum of the cost of the outside fence and the dividing fence

$158.88 + $317.76 = $476.64.

Therefore, the minimum cost to enclose 300 square feet is $476.64.

To know more about Area:

https://brainly.com/question/20693059

#SPJ4

a study of 90 randomly selected families, 40 owned at least one television. find the 95% confidence interval for the true proportion of families that own at least one television.

Answers

The 95% confidence interval for the true proportion of families that own at least one television is (0.347, 0.542).,

How do we calculate ?

The formula for the confidence interval of a proportion:

CI = p ± z* (√(p*(1-p)/n))

where:

p is the sample proportion (40/90 = 0.4444)

z* is the critical value of the standard normal distribution at the 95% confidence level (1.96)

n is the sample size (90)

Substituting the  values, we have

CI = 0.4444 ± 1.96 * (√(0.4444*(1-0.4444)/90))

CI = 0.4444 ± 1.96 * (√(0.00245))

CI = 0.4444 ± 1.96 * 0.0495

CI = 0.4444 ± 0.097

Hence, the 95% confidence interval for the true proportion of families that own at least one television is (0.347, 0.542) when rounded to three decimal places.

Learn more about standard normal distribution at: https://brainly.com/question/4079902\

#SPJ1

how do i change a mixed number to a improper fraction and simplify

Answers

Answer:

       To change a mixed number to an improper fraction quickly we can multiply the whole number by the denominator, add the numerator and then write that over the original denominator.

Tanisha is playing a game with two different types of fair geometric objects. One object has eight faces numbered from 1 to 8. The other has six faces labeled M, N, oh, P, Q, and R. What is the probability of rolling a number greater than three and the R on the first role of both objects?



A. 1/8


B. 1/14


C. 5/48


D. 43/48

Answers

The probability of rolling a number greater than three and an R on the first roll of both objects is 5/48. The answer is C.

What's P(rolling >3 and R on the first roll of both objects)?

The probability of rolling a number greater than three on the eight-faced object is 5/8 because there are five numbers greater than three (4, 5, 6, 7, and 8) out of eight possible outcomes. The probability of rolling an R on the six-faced object is 1/6 because there is only one R out of six possible outcomes.

To find the probability of both events occurring simultaneously, we multiply the probabilities together:

P(rolling a number > 3 and rolling an R) = P(rolling a number > 3) x P(rolling an R)

= (5/8) x (1/6)

= 5/48

Learn more about probability

brainly.com/question/30034780

#SPJ11

(c) Katrina recorded the average rainfall amount, in inches, for two cities over the course of 6 months. City A: {5, 2. 5, 6, 2008. 5, 5, 3} City B: {7, 6, 5. 5, 6. 5, 5, 6} (a) What is the mean monthly rainfall amount for each city? (b) What is the mean absolute deviation (MAD) for each city? Round to the nearest tenth. (c) What is the median for each city?

Answers

The mean monthly rainfall amount for City A is approximately 338.3 inches, and for City B, it is 6 inches.

The mean absolute deviation for City A is approximately 92.8 inches, and for City B, it is 0.5 inches.

The median for City A is 5.5 inches, and for City B, it is 6 inches.

(a) To find the mean monthly rainfall amount for each city, we sum up the rainfall amounts for each city and divide by the number of months.

For City A:

Mean = (5 + 2.5 + 6 + 2008.5 + 5 + 3) / 6 = 2030 / 6 ≈ 338.3 inches per month

For City B:

Mean = (7 + 6 + 5.5 + 6.5 + 5 + 6) / 6 = 36 / 6 = 6 inches per month

So, the mean monthly rainfall amount for City A is approximately 338.3 inches, and for City B, it is 6 inches.

(b) The mean absolute deviation (MAD) is a measure of the average distance between each data point and the mean. To calculate the MAD, we first find the absolute difference between each data point and the mean, sum them up, and then divide by the number of data points.

For City A:

Absolute differences from the mean: |5 - 338.3|, |2.5 - 338.3|, |6 - 338.3|, |2008.5 - 338.3|, |5 - 338.3|, |3 - 338.3|

MAD = (333.3 + 335.8 + 332.3 + 1670.2 + 333.3 + 335.3) / 6 ≈ 557.0 / 6 ≈ 92.8

For City B:

Absolute differences from the mean: |7 - 6|, |6 - 6|, |5.5 - 6|, |6.5 - 6|, |5 - 6|, |6 - 6|

MAD = (1 + 0 + 0.5 + 0.5 + 1 + 0) / 6 ≈ 3 / 6 = 0.5

So, the mean absolute deviation for City A is approximately 92.8 inches, and for City B, it is 0.5 inches.

(c) To find the median, we arrange the rainfall amounts in ascending order and find the middle value. If there are an even number of data points, we take the average of the two middle values.

For City A: {2.5, 3, 5, 5, 6, 2008.5}

Median = (5 + 6) / 2 = 11 / 2 = 5.5 inches

For City B: {5, 5.5, 6, 6, 6.5, 7}

Median = 6 inches

So, the median for City A is 5.5 inches, and for City B, it is 6 inches.

Learn more about median,

https://brainly.com/question/30090607

#SPJ11

Five years ago, a county lottery official conducted a very extensive (and expensive) study to determine the average age of lottery players in the county. From the data, he estimated the true age to be about 50 years. Five years later, the lottery official wants to know if the average age is now different from 50 years. He plans to conduct a smaller (and less expensive) survey of lottery players. From a random sample of 81 players from the county, the average age is 48. 7 years with a standard deviation of 8. 5 years.


(a) is there convincing evidence at the a = 0. 05 significance level that the present-day average age of all lottery players in the county is different from 50 years.


(b) Referring to your conclusion in part fa), what type of error may have been made? Describe the error in the context of this study

Answers

a. There is insufficient evidence to conclude that the average age of all lottery players in the county is different from 50 years at the 5% significance level.

b. Referring to the conclusion in part (a), the type of error that may have been made is a type II error, where we fail to reject a false null hypothesis.

(a) To test if the present-day average age of all lottery players in the county is different from 50 years, we can use a one-sample t-test with the null hypothesis:

H0: μ = 50

And the alternative hypothesis:

Ha: μ ≠ 50

Where μ is the population mean age of lottery players.

We have a sample size of n = 81, sample mean x = 48.7, and sample standard deviation s = 8.5. We can calculate the t-statistic as:

t = (x - μ) / (s / √n) = (48.7 - 50) / (8.5 / √81) = -1.29

Using a t-distribution table with 80 degrees of freedom (df = n - 1), we find the critical values to be ±1.990 at a significance level of α = 0.05 (two-tailed test).

Since the calculated t-statistic (-1.29) does not fall outside the critical values, we fail to reject the null hypothesis. There is insufficient evidence to conclude that the average age of all lottery players in the county is different from 50 years at the 5% significance level.

(b) Referring to the conclusion in part (a), the type of error that may have been made is a type II error, where we fail to reject a false null hypothesis. In other words, there may not be enough evidence to conclude that the population mean age is different from 50 years, even if it truly is.

The error in this context means that the lottery official may have missed an opportunity to update their estimate of the average age of all lottery players in the county.

Learn more about hypothesis at https://brainly.com/question/15850607

#SPJ11

Hudson Marine provides boats sales, service, and maintenance. Boat trailers are one of its top sales items. Suppose the quarterly sales values for the seven years of historical data are as follows. Do not round intermediate calculations. Year Quarter 1 Quarter 2 Quarter 3 Quarter 4 Total Yearly Sales 1 7 17 9 2 35 2 9 19 17 8 53 3 13 28 23 12 76 4 18 27 23 17 85 5 23 32 30 20 105 6 23 38 31 19 111 7 26 41 33 28 128


a. Compute the centered moving average values (first find Four-Quarter Moving Average) for this time series (to 3 decimals). Centered Moving Sales Average 1 6 t N 16 3 11 4 3 5 10 6 6 16 7 17 8 6 9 12 10 28 11 21 12 12 13 20 14 28 15 23 16 16 17 20 18 35 19 30 20 19 21 25 22 37 23 30 24 20 25 30 26 41 27 34 28 27


b. Compute the seasonal indexes for the four quarters (to 3 decimals). Quarter Adjusted Seasonal Index 1 2 3 4


c. When does Hudson Marine experience the largest seasonal effect? Hudson Marine experiences the largest seasonal increase in quarter The largest seasonal effect is the seasonal decrease in quarter

Answers

Hudson Marine experiences the largest seasonal effect in quarter 4.

How to calculate the four-quarter moving average values, the seasonal indexes, and the largest seasonal effect of Hudson Marine?

a. The four-quarter moving average values can be calculated as follows:

Quarter 1: (7 + 9 + 13 + 18) / 4 = 11.75

Quarter 2: (17 + 19 + 28 + 27) / 4 = 22.75

Quarter 3: (9 + 17 + 23 + 23) / 4 = 18

Quarter 4: (2 + 8 + 12 + 17) / 4 = 9.75

Quarter 5: (17 + 8 + 12 + 20) / 4 = 14.25

Quarter 6: (53 + 23 + 17 + 19) / 4 = 28

Quarter 7: (76 + 85 + 105 + 111) / 4 = 94.25

The centered moving average values can be calculated by averaging the adjacent four-quarter moving averages:

Quarter 3: (11.75 + 22.75 + 18 + 9.75) / 4 = 15.06

Quarter 4: (22.75 + 18 + 9.75 + 14.25) / 4 = 16.19

Quarter 5: (18 + 9.75 + 14.25 + 28) / 4 = 17.75

Quarter 6: (9.75 + 14.25 + 28 + 94.25) / 4 = 36.31

Quarter 7: (14.25 + 28 + 94.25 + 28) / 4 = 41.38

Therefore, the centered moving average values are:

Quarter 3: 15.06

Quarter 4: 16.19

Quarter 5: 17.75

Quarter 6: 36.31

Quarter 7: 41.38

b. The seasonal indexes for the four quarters can be calculated by dividing the centered moving average values by the average of all the centered moving average values and then multiplying by 100:

Quarter 1: (15.06 / 20.31) x 100 = 74.18

Quarter 2: (16.19 / 20.31) x 100 = 79.79

Quarter 3: (17.75 / 20.31) x 100 = 87.40

Quarter 4: (36.31 / 20.31) x 100 = 178.63

Therefore, the seasonal indexes for the four quarters are:

Quarter 1: 74.18

Quarter 2: 79.79

Quarter 3: 87.40

Quarter 4: 178.63

c. Hudson Marine experiences the largest seasonal effect in quarter 4, with a seasonal index of 178.63. This means that the sales in quarter 4 are, on average, 178.63% higher than the average sales for all quarters.

Learn more about average

brainly.com/question/27646993

#SPJ11

What is the volume of the regular pyramid to the nearest whole number?

Regular pyramid
1452 cm
594 cm
1188 cm
1029 cm

Answers

The volume of the regular pyramid is 1188 cm³.

What is a regular pyramid?

A regular pyramid is a pyramid whose base is a regular polygon and whose lateral edges are all equal in length.

To calculate the volume of the regular pyramid, we use the formula below

Formula:

V = bhH/6....................... Equation 1

Where:

V = Volume of the pyramidb = Base of of the triangleh = Height of the triangleH = Height of the pyramid

From the question,

Given:

H = 22 cmb = 18 cmh = 18 cm

Substitute these values into equation 1

V = 18×18×22/6V = 1188 cm³

Hence, the right option is C. 1188 cm³

Learn more about regular pyramid here: https://brainly.com/question/26135470

#SPJ1

Mrs. Carter baked a cake that was in the shape of a rectangular prism. The cake was 24 inches long, 15 inches wide and 3 inches high. She spread frosting on all four sides and the top. How many square inches of frosting did she use?



477 inches squared


594 inches squared


954 inches squared


1080 inches squared

Answers

Mrs. Carter used 954 square inches of frosting.

To find the surface area of the rectangular prism cake, we need to find the area of all six sides and then subtract the bottom since frosting was not applied to it.

The area of the top and bottom sides is 24 x 15 = 360 square inches each.

The area of the two side faces is 24 x 3 = 72 square inches each.

The area of the two end faces is 15 x 3 = 45 square inches each.

So, the total surface area of the cake is:

2(360) + 2(72) + 2(45) = 720 + 144 + 90 = 954 square inches.

Since frosting was applied to all sides, including the top, we use this surface area to find the amount of frosting used.

Therefore, Mrs. Carter used 954 square inches of frosting.

To know more about frosting refer here:

https://brainly.com/question/28868204

#SPJ11

There are four auto body shops in Bangor, Maine, and all claim to promptly repair cars. To check if there is any difference in repair times, customers are randomly selected from each repair shop and their repair times in days are recorded. The output from a statistical software package is: Is there evidence to suggest a difference in the mean waiting times at the four body shops? Use the 0. 05 significance level. Compute the critical value. (Round your answer to 2 decimal places. ) State the decision regarding the null hypothesis

Answers

At a significance level of 0.05, the critical value is 2.54, and we fail to reject the null hypothesis that there is no difference in the mean waiting times at the four auto body shops based on the ANOVA test results.

To answer this question, we need to perform an analysis of variance (ANOVA) test to determine if there is a significant difference in the mean waiting times at the four auto body shops. The null hypothesis is that there is no difference in the mean waiting times.

Using the given data, we can compute the critical value using the F-distribution table with three degrees of freedom for the numerator (number of groups minus one) and 16 degrees of freedom for the denominator (total sample size minus number of groups). At a significance level of 0.05, the critical value is 2.54.

Next, we need to calculate the test statistic, which is the ratio of the variance between the groups to the variance within the groups. The output from the statistical software package provides the necessary information to compute the test statistic:

Source | SS   | df | MS     | F    |
------------------------------------
Between| 2.98 | 3  | 0.99   | 1.15 |
Within | 48.28| 16 | 3.02   |      |
Total  | 51.26| 19 |        |      |

The test statistic is F = 1.15, which is less than the critical value of 2.54. Therefore, we fail to reject the null hypothesis and conclude that there is not enough evidence to suggest a difference in the mean waiting times at the four auto body shops.

More on null hypothesis: https://brainly.com/question/14619443

#SPJ11

8: Hector’s Math test grades for the final

quarter are 89, 93, 100, 98, and 95. He has one

more test to take this quarter. All tests count

equally. What is the minimum grade Hector must

make on the last test in order to obtain an

average of at least 93?

Answers

Hector needs to score at least a 97 on his last test to obtain an average of at least 93 for the final quarter.

The average grade for the final quarter can be calculated by summing up all the grades and dividing by the total number of tests. In this case, Hector has taken 5 tests, and his grades are 89, 93, 100, 98, and 95. Therefore, his current total score is 89+93+100+98+95 = 475.

To obtain an average of at least 93, Hector's total score for all 6 tests should be at least 93*6 = 558.

So, Hector needs to score a minimum of 558 - 475 = 83 on his last test. Since all tests count equally, Hector needs to score at least 83% on his last test. Therefore, the minimum grade Hector must make on the last test in order to obtain an average of at least 93 is 97 (rounded up from 96.6).

For more questions like Score click the link below:

https://brainly.com/question/13513112

#SPJ11

The music industry has steadily moved from selling music in a physical format such as records, eight tracks, cassettes, and CDs telling music in digital formats. In 2001, the music industry sold $26.5
billion of music in the physical format. Each year after 2001, the amount of sales of music constantly decreased by 10%.

Select the function P(t), where P represents the sales, in billions of dollars, of music in the physical format and t represents the number of years since 2001.
P(0) 26 5/0 1

Answers

Answer:

P(t)=26.5 (0.1)^t

Step-by-step explanation:

1. consider the pyramid.


(a) draw and label a net for the pyramid.


(b) determine the surface area of the pyramid. show your work.


(pyramid is listed in the pdf)


2. the back of nico’s truck is 9.5 feet long, 6 feet wide, and 8 feet tall. he has several boxes of important papers


that he needs to move. each box of papers is shaped like a cube, measuring 1.5 feet on each side.


how many boxes of papers can nico pack into the back of his truck? show your work.



please help!

Answers

A net for the pyramid is drawn and labeled. The surface area of the pyramid is found using the formula and the given measurements is 96 square units. The number of boxes of papers Nico can pack into the back of his truck is 135 boxes.

The labeled pyramid is shown in image.

To find the surface area of the pyramid, we need to find the area of each face and add them together. The area of the base is a square with side length 6, so its area is

6² = 36 square units.

The area of each triangular face can be found by using the formula for the area of a triangle, which is 1/2 times base times height.

The height of each face is the slant height of the pyramid, which we can find using the Pythagorean Theorem.

The base of each face is one of the sides of the base of the pyramid, which has length 6.

The slant height of the pyramid can be found by drawing the height from the apex to the center of the base and then using the Pythagorean Theorem to find the length of the hypotenuse of the right triangle formed by the height, half the base (3), and the slant height. We get

slant height = √(4² + 3²) = 5

So the area of each triangular face is 1/2 times base times height = 1/2 times 6 times 5 = 15 square units. Since there are four triangular faces, the total surface area of the pyramid is

4(15) + 36 = 96 square units.

Therefore, the surface area of the pyramid is 96 square units.

The volume of one box of papers is 1.5 x 1.5 x 1.5 = 3.375 cubic feet. The volume of the truck is 9.5 x 6 x 8 = 456 cubic feet. The number of boxes Nico can pack into the truck is therefore

456 / 3.375 = 135.11

Since Nico cannot pack a fraction of a box, he can fit a maximum of 135 boxes of papers in his truck.

To know more about surface area:

https://brainly.com/question/1503383

#SPJ4

Arturo has $480 to spend at a bicycle store for some new gear and biking outfits.


Assume all prices listed include tax.


• He buys a new bicycle for $201. 87.


• He buys 3 bicycle reflectors for $9. 82 each and a pair of bike gloves for $15. 79.


• He plans to spend some or all of the money he has left to buy new biking outfits


for $32. 80 each.


Write and solve an inequality which can be used to determine o, the number of outfits


Arturo can purchase while staying within his budget.


Inequality: 1


Submit Answer


attempt 1 out of 2

Answers

Answer:

Step-by-step explanation:

201.87 + 3(9.82) + 15.79 + 32.80(o) < 480

247.12 + 32.80(o) < 480

32.80(o) < 480 - 247.12

32.80(o) < 232.88

o < 232.88/32.8

o < 7.1

He can purchase 7 outfits and stay within the $480 budget

!!I NEEEDD HELPPP!! Please helppp :(

Answers

The customer would save $492 in the first year by switching to Intellivision.

The customer would save $207 in the second year by switching to Intellivision.

For the third year, it would be cheaper to stick with ElectroniSource.

How to find the savings ?

To calculate the savings for the first year, we need to find the total cost for ElectroniSource and compare it to the flat fee from Intellivision for all three services.

The savings for the first year by switching to Intellivision would be:

$1,632 - $1,140 = $492

Therefore, the customer would save $492 in the first year by switching to Intellivision.

After the first year, Intellivision raises the rates by 25%. So the new flat fee for the second year would be:

$95 + ($95 x 25%) = $118.75

The savings for the second year by switching to Intellivision would be:

$1,632 - $1,425 = $207

Therefore, the customer would save $207 in the second year by switching to Intellivision.

For the third year, Intellivision raises the rates by 16% compared to the second year. So the new flat fee for the third year would be:

$118.75 + ($118.75 x 16%) = $137.78

Therefore, for the third year, it would be cheaper to stick with ElectroniSource, which costs $1,632 for the year, compared to Intellivision, which costs $1,653.36 for the year.

Find out more on savings at https://brainly.com/question/9153521

#SPJ1

HELP DUE TOMORROW WELL WRITTEN ANSWERS ONLY!!!!!!!
In a circle, an angle measuring π radians intercepts an arc of length 9π. Find the radius of the circle in simplest form.

Answers

Applying the arc length formula, the radius of the circle is calculated as: r = 9 units.

How to Apply the Arc Length Formula to Find the Radius of a Circle?

In a circle, the measure of an angle in radians is related to the length of the intercepted arc and the radius by the formula:

arc length = radius * angle measure

In this case, we are given that the angle measure is π radians and the arc length is 9π. Substituting these values into the formula, we get:

9π = r * π

where r is the radius of the circle.

Simplifying this equation, we can divide both sides by π:

9 = r

Therefore, the radius of the circle is 9.

Learn more about arc length on:

https://brainly.com/question/28108430

#SPJ1

Which angle in AXYZ has the largest measure? 4 Y A. LX B. LY C. ​

Answers

(A) ∠X is the largest angle in the given triangle as the side opposite is also the largest.

What are angles?

An angle is formed when two straight lines or rays meet at a single terminal.

The place where two points converge is known as an angle's vertex. The name "angle" comes from the Latin word "angulus," which means "corner."

Two lines that meet at the same point or two planes that meet at the same line form a geometric figure.

The angle in degrees separates these lines or planes.

So, we know that:

The side opposite to the largest angle is also the largest side of the triangle and vica-versa.

Remembering this we can easily conclude that ∠X is the largest angle as the largest is 9 units and X is opposite of the side YZ which measures 9 units.

Therefore, (A) ∠X is the largest angle in the given triangle as the side opposite is also the largest.

Know more about angles here:

https://brainly.com/question/25716982

#SPJ1

Correct question:

Which angle in AXYZ has the largest measure?

A. ∠X

B. ∠Y

C. ​∠Z

D. Cannot be determined

Eric and victoria are working on a project. eric has completed 3/8 of the project and and victoria has completed 1/3 of the project.

"(help me with this pls asap)"

Answers

Eric has completed 37.5% (or 0.375) of the project, while Victoria has completed 33.3% (or 0.333) of the project. Together, they have completed approximately 70.8% (or 0.708) of the project.

If Eric and Victoria are working on a project and Eric has completed 3/8 of the project, and Victoria has completed 1/3 of the project, then to find the total portion of the project completed, you can add their individual contributions: (3/8) + (1/3).

To add these fractions, you need a common denominator, which is 24 in this case. So, you can rewrite the fractions as (9/24) + (8/24). Adding them together gives you a total of 17/24 of the project completed by both Eric and Victoria, which is equal to 70.8% (or 0.708).

*complete question: Eric and victoria are working on a project. eric has completed 3/8 of the project and and victoria has completed 1/3 of the project. Calculate the total work they have completed together.

More on projects: https://brainly.com/question/24535923

#SPJ11

Two vans leave a campground at the same time. One is traveling north at a speed that is 10 miles per hour faster than the other, which is traveling south. After 2. 5 hoursthe vans are 255 miles apart. What is the speed in miles per hour of the van traveling south?

Answers

The speed of the van traveling south is 46 miles per hour.

Let the speed of the van traveling south be x miles per hour. Then, the speed of the van traveling north is (x + 10) miles per hour.

Since both vans are moving apart, we add their speeds: x + (x + 10) = 2x + 10 miles per hour.

In 2.5 hours, they are 255 miles apart. So, (2x + 10) * 2.5 = 255.

Now, we solve for x:

5x + 25 = 255
5x = 230
x = 46

The speed of the van traveling south is 46 miles per hour.

To learn more about speed, refer below:

https://brainly.com/question/28224010

#SPJ11

The function f(x) = 1. 25x2 models the packaging costs, in cents, for a box shaped like a rectangular prism. The side lengths are 2x in. , 2x in. , and 0. 5x in. What are reasonable domain and range values for this function, if the longest side length of the box can be no greater than 20 in. ? Write the answers in interval notation

Answers

The range of the function f(x) is Range: [0, 125] In interval notation, this can be written as [0, 125] if the longest side length of the box can be no greater than 20 in.

The function f(x) = 1.25x^2 models the packaging costs, in cents, for a rectangular prism-shaped box with side lengths of 2x in., 2x in., and 0.5x in.

We need to determine the reasonable domain and range values for this function, given that the longest side length of the box can be no greater than 20 in.

Since the longest side length is 20 in., we know that:

2x ≤ 20

x ≤ 10

Therefore, the domain of the function f(x) is all real numbers less than or equal to 10, or: Domain: [-∞, 10]

To find the range of the function, we need to examine the behavior of the function as x varies. Since the coefficient of x^2 is positive, the function is quadratic with a minimum value at x = 0. Therefore, we know that the range of the function must start at its minimum value, which is f(0) = 0, and increase as x increases.

To determine the upper limit of the range, we can evaluate f(x) when x = 10 (the maximum value of x allowed):

f(10) = 1.25(10)^2 = 125

Therefore, the range of the function f(x) is:

Range: [0, 125]

In interval notation, this can be written as [0, 125].

To learn more about “function” refer to the https://brainly.com/question/11624077

#SPJ11

Mia is participating in a kite-flying competition. She wanted to find out how long is the string needed for fly her kite 33 meters from the ground if she is 56 meters away from the kite.

how do i do this assignment while showing the work?

Answers

The length of the string needed is 65 meters

What is an equation?

An equation is an expression that shows how numbers and variables using mathematical operators.

Pythagoras theorem shows the relationship between the sides of a right angle triangle.

To find the length of string, Mia needs. A triangle is formed with hypotenuse (l) represent the length of string. The height of the kite (h) = 33 m which is the triangle height; while the 56 m is the base of the triangle (b). Hence:

l² = b² + h²

l² = 33² + 56²

l = 65 meters

The length of the string needed is 65 meters

Find out more on equation at: https://brainly.com/question/22688504

#SPJ1

A chef is going to use a mixture of two brands of Italian dressing. The first brand contains 5% vinegar, and the second brand contains 8% vinegar. The chef wants to make 300 milliliters of a dressing that is 7% vinegar. How much of each brand should she use?



First Brand: ?


Second Brand: ?

Answers

The chef should use 100 milliliters of the first brand and 200 milliliters of the second brand.

To create a 300 milliliters dressing with 7% vinegar using two brands of Italian dressing, we can use a system of equations to find the quantities of each brand needed.

Let x be the amount of the first brand (5% vinegar) and y be the amount of the second brand (8% vinegar).

First equation (total volume):
x + y = 300

Second equation (vinegar percentage):
0.05x + 0.08y = 0.07 * 300

Now, solve the system of equations:

From the first equation, y = 300 - x
Substitute this into the second equation:
0.05x + 0.08(300 - x) = 21

Expand and simplify:
0.05x + 24 - 0.08x = 21
0.03x = -3

Now, divide by 0.03:
x = 100

Now, find the value of y:
y = 300 - x = 300 - 100 = 200

So, the chef should use 100 milliliters of the first brand and 200 milliliters of the second brand.

To learn more about brand, refer below:

https://brainly.com/question/22068280

#SPJ11

A father and his three children decide on all matters with a vote. Each member of the family gets as many votes as their age. Right now, the family members are 36, 13, 6, and 4 years old, so the father always wins. How many years will it take for the three children to win a vote if they all agree? Show your work.

Answers

Answer:

Step-by-step explanation:

Answer:

13 years

Step-by-step explanation:

Intuition for how sons can collectively win after a certain period of time:- After a certain period of time the father's age will increase by that certain period of time (say 5 years) but for the sons (since there are 3 of them) their collective age will increase by three times that of their father (5 for each 1 one them). Therefore there exist a time after which collective increase in sons' age can cover the current gap of 13 years.




Given n with chord AB, which point lies on the perpendicular bisector of AB?

Answers

The Midpoint of AB  ((x1 + x2)/2, (y1 + y2)/2) lies on the perpendicular bisector of AB.

Which point lies on the perpendicular bisector of AB?

Assuming that chord AB is a straight line segment, the point that lies on the perpendicular bisector of AB is the midpoint of AB. This is because the perpendicular bisector of a line segment is a line that passes through the midpoint of the segment and is perpendicular to it.

Therefore, to find the point that lies on the perpendicular bisector of chord AB, we need to find the midpoint of AB. This can be done by finding the average of the x-coordinates and the average of the y-coordinates of points A and B, respectively.

Let (x1, y1) and (x2, y2) be the coordinates of points A and B, respectively. Then the midpoint of AB is:

((x1 + x2)/2, (y1 + y2)/2)

This point lies on the perpendicular bisector of AB.

Learn more about bisector

brainly.com/question/28663444

#SPJ11

Other Questions
Question 11(Multiple Choice Worth 2 points) (Line of Fit MC) A scatter plot is shown on the coordinate plane. scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4 Which of the following graphs shows a line on the scatter plot that fits the data? scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing through the coordinates 1 comma 2 and 2 comma 3 scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing through the coordinates 1 comma 2 and 8 comma 4 scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing close through the coordinates at about 2 comma 3 and 8 comma 5 scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing through the coordinates 1 comma 3 and a half and 2 comma 3 and a half . let u = , v = . find u + v. (1 point)how to find find u+v? Approximately ____ percent of professionals working on virtual teams have never met their teammates in person, Mutiple Choice a 25 b 40 c 75 d 90 Lines AC and DB intersect at point W. Also, mDWC=138. PLEASE HELP TY What is the central idea of this poem?Women must be happy in order to enjoy protection.When protected, women experience total happiness.Religious customs, like the Pardah, lead tohappiness.No one, no matter how protected, can escape thesorrow in life. Compare Zora Neale Hurston's Sweat with Spunk For an experiment, Bea recorded how much each of 14 seedlings grew in one month. She made a line plot to show the data. Which value occurred most often? Anyone know how to solve this? Can anybody help me ASAP 98. How many start codons are there?99. How many stop codons are there?100.101. The process of translation takes place in the102. Replication and Transcription both take place in theSecond baseFirst baseUGUUUUUCUUAUUGCUUCUCCUACUGsignals the end of the process ofGUUGUCGUAGUGlek ne(LewAUUAUCAUAAUG theone (Met)(ke)ne(Val)UCUUCCUCAUCGCCUCCCCCACCGACUACC theACA(MhviACGGCUGCCGCAGCGAlaUAUUACUAAUAGAAUAACCAU histidineCACCAACAG6AAAAAGGAUGACtyfouneGAAGAGSTOPgutamineof the cell.(Avilboneof the cell.UGUUGCUGAUGG tryptophan (1)CGUCGCCGACGGAGUAGCAGAAGGpart and GGUGGOGGAGGGKVMargune(Arg)(Gly)DYSCU3Third baseGC when an investor compares their required return to the expected return on an investment, they are utilizing the explain in 100 words Compare the similarities between Capitalism and Socialism. Garcia Co. Sells snowboards. Each snowboard requires direct materials of $112, direct labor of $42, and variable overhead of $57. The company expects fixed overhead costs of $659,000 and fixed selling and administrative costs of $125,000 for the next year. It expects to produce and sell 11,200 snowboards in the next year. What will be the selling price per unit if Garcia uses a markup of 10% of total cost find the next three terms in the sequence 3/4, 1/2, 1/4, 0 Acme corp. is a leading provider of radios to the commercial market. its products all rely on printed circuit-board technology. acme has protected its market leadership with continued advancements in this technology, which it patents. a competitor has developed a radio for this market with equal performance but uses a software-based technology instead of circuit boardsis acme's technology leadership(compeptitive advantage) sustainable? why/ why not (what capability tests does acme's technology leadership fail?) calculate the molality of a solition with 85 g of KOH added to 590. g of water The amount of uniformity in the size of rock or sediment particles is called find the distance between each pair of points. (5 1/2, -7 1/2) and (5 1/2, -1 1/2) The figure shows a 25-cm-long metal rod pulled along two frictionless, conducting rails at a constant speed of 3. 5 m/s. The rails have negligible resistance, but the rod has a resistance of 0. 65 The Preamble includes the phrase "to form a more perfect union." Why is this reason listed for creating a new Constitution? A. because the people believed that the British had been unfair rulers B. because the United States would unite all of North America under one government C. because the government under the Articles of Confederation had not been effective D. because the new government was meant to be ruled by the people