i need help with biology if you’re willing to help pls lmk :)
Answer:
sddssa
Explanation:sa
Please help ASAP! I have about 30 questions more to answer, so It would be so helpful if you answered this question. Thank you!
What do agriculture and urbanization have in common?
Answer:
Agriculture and urbanization both have the goal of expanding human value of living.
Explanation:
Answer:
Explanation:
Basically both of them benefit each other .
Urbanization brings major changes in demand for agricultural products both from increases in urban populations and from changes in their diets and demands. It can also bring major challenges for urban and rural food security.
Hope this helped !
15 points answer please
Answer:
B
Explanation:
Which molecule is produced in the aerobic breakdown of a glucose molecule?
A. Water
B. Oxygen
C. Light
D. Alcohol
E. NADPH
[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]
E. NADPH
thankshope it helpspls mark as brainliestAnswer:
E
Explanation:
it enters the citric acid cycle and generates reducing equivalents in the form of NADPH
Lysogenic viruses do not
Answer:
Unlike a lytic virus, a lysogenic virus does not cause the host cell to lyse away. A lysogenic virus can remain inactive for a period of time. In lysogenic infection, viral DNA gets integrated with the host cell's DNA, where it is copied along with the host cell's DNA when the host cell replicates.
Explanation:
What type of bond holds nitrogen bases together? And, how many of these hold Guanine and Cytocine together?
Organisms such as yeast can reproduce through mitotic division. During this type of reproduction, nondisjunction is possible.
True
False
Select the correct answer. A roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates. How much energy does the sandwich provide? A. 747 calories B. 542 calories C. 502 calories D. 367 calories E. 332 calories
Answer:
D. 367
Explanation:
If a roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates, it contains 367 calories of energy, hence option D is correct.
What is food energy?Animals obtain the chemical energy known as "food energy" from their food in order to maintain their metabolism, which includes their muscular activity.
The majority of animals get most of their energy via aerobic respiration, which involves mixing carbs, lipids, and proteins with air or water-based oxygen.
To find the total calories, multiply the given biomolecules grams with their calorie count.
= 42 × 4 + 7 × 9 + 34 × 4
= 168 + 63 + 136
= 367 calories
Therefore, the sandwich provides 367 calories of energy, if it contains 42 g protein, 7 g fat, and 34 g carbohydrates.
Learn more about energy, here:
https://brainly.com/question/839331
#SPJ5
You cross nonpure tall plants (Tt) and produce 200
offspring. Which of the following statements about
the offspring is correct?
A. All of the offspring will definitely be tall.
B. 150 of the offspring will definitely be tall.
C. There is a 75% chance that each offspring
will be tall.
O D. There is a 25% chance that each offspring
will be tall.
Answer:
C is the best answer
Explanation:
the dominate trait is in 3 of the four boxes
There is a 75% chance that each offspring will be tall. Therefore option C is correct.
When you cross non-pure tall plants (Tt), you are dealing with a heterozygous genotype, meaning the plants have one dominant (T) and one recessive (t) allele for the height trait.
The dominant allele (T) is responsible for the tall phenotype, while the recessive allele (t) leads to short plants. In this case, 75% of the offspring will likely receive the dominant allele from at least one parent (Tt or TT) and therefore be tall.
The remaining 25% will inherit the recessive allele from both parents (tt) and be short. This is based on the principles of Mendelian genetics and the Punnett square.
Therefore option C There is a 75% chance that each offspring will be tall is correct.
Know more about genotype:
https://brainly.com/question/31515990
#SPJ5
Will this process below ensure with certainty that the offspring will retain their needles? Explain your answer.
Chastagner emphasizes that homeowners can minimize needle shedding by keeping their displayed trees well-supplied with water. In fact, when he has set up trees for research in early December and kept them watered, some species, like noble and Nordmann fir, have gone even three months with only minimal shedding.
Answer:
I'm in school I'll help you when get home around 4:30
A.GL, Gl, gL, gl
B.GG, Gg. LL, Ll
C.GL, Gl
D.GG, Ll
Answer:
GL Gl gL gl
Explanation:
Why does Mr. Brunner care for Percy so much?
why do some scientists believe that humans evolved from apes?
a: because fossil records show homologous structures indicating a common ancestor
b: because humans and apes lived around the same time period
Answer:
A
Explanation:
Because it is way more logic
Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a difference in the structure of proteins and polysaccharides? *
A. forming a variety of gametes that will pass on hereditary information
B. disrupting meiosis and the synthesis of amino acids into a sequence
C. producing the inorganic molecules needed for normal cell growth
D. directing the synthesis of proteins necessary for proper cell function
D. directing the synthesis of proteins necessary for proper cell function
I hope this helps a little.
Which two words best describe the Sun? Select one:
A)planet and gases
B)star and rocky
C) star and gases
D)planet and rocky
Answer:
I'm pretty sure it would be c
Explanation:
because it is a star so it definitely is not a or d and I don't think it is rocky soooo
The acidity of the water in a stream is indicated by its pH. Historically, a certain stream has had a pH of 6.0. Acid rain has caused the stream's pH to become 4.8. Which statement predicts how the stream's ecosystem will most likely be impacted? A The flow rate of the stream will increase B. The flow rate of the stream will decrease. с The number of fish in the stream will increase. D The number of fish in the stream will decrease.
The statement predicts how the stream's ecosystem will most likely be impacted is the number of fish in the stream will decrease. Thus, option D is correct.
What is the procedure to indicate the pH of the water stream?The acidity of the water in a stream is indicated by its pH. Historically, a certain stream has had a pH of 6.0. Acid rain has caused the stream's pH to become 4.8.The flow rate of the stream will decrease. The number of fish in the stream will increase and the number of fish in the stream will decrease.
Acid rain is a form of rain with high concentration of hydrogen ions and is acidic in nature. pH of these rains is low and pH is the negative logarithmic of hydrogen ion concentration. It is known as power of hydrogen.
The animal which has the lowest value of pH will be able to tolerate the acid rain more and will be last to die. From the tolerance range of the animals, frogs has the lowest pH for survival which is 4 and it can bear more acid rain than the rest of the animals will be the last to die.
Therefore, The statement predicts how the stream's ecosystem will most likely be impacted is the number of fish in the stream will decrease. Thus, option D is correct.
Learn more about acid rain on:
https://brainly.com/question/11543614
#SPJ2
GIVING BRAINLIEST AND EXTRA POINTS!!
The octopus can change its coloring to blend into its environment, and the sweet pinesap plant appears to look like dead leaves on the ground. How do these adaptations help the plant and animal survive?
A) They protect them from predators.
B) They protect them from the environment.
C) They allow them to stand out.
D) They allow them to reproduce.
Outline the process of the Carbon Cycle.
Answer:
Carbon Cycle Definition
Carbon cycle is the process where carbon compounds are interchanged among the biosphere, geosphere, pedosphere, hydrosphere, and atmosphere of the earth.
Carbon Cycle Steps
Following are the major steps involved in the process of the carbon cycle:
Carbon present in the atmosphere is absorbed by plants for photosynthesis.
These plants are then consumed by animals and carbon gets bioaccumulated into their bodies.
These animals and plants eventually die, and upon decomposing, carbon is released back into the atmosphere.
Some of the carbon that is not released back into the atmosphere eventually become fossil fuels.
These fossil fuels are then used for man-made activities, which pumps more carbon back into the atmosphere.
Hope it helps!!!
what is the complementary DNA of TACCGGATGCCAGATCAAATC?
Answer:
ATGGCCTACGGTCTAGTTTAG
Explanation:
A=T
C=G
G=C
T=A
This is the key to finding a complementary DNA strand.
How are primary and secondary ecological succession similar?
1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.
Answer:
I don't know
Explanation:
I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?
1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.
Hold on, our servers are swamped. Wait for your answer to fully load.
Acid rain is caused by: *
*
O
a. Mass amount of CO2 in the atmosphere
O b. Reduction of pollutants
O c. Organisms that release acid into the atmosphere
O d. Planting more trees
Answer:
Mass amount of CO2 in the atmosphere
The 1st organism in a food chain must always be what type of organism?
Answer:
Producer
Explanation:
I think it should be producer.
Answer:
Producer
Explanation:
The 1st organism in a food chain must always be what type of organism?
Producer
What are the factors that determine
the level of harm an introduced chemical
has on the enviroment?
PLEASE ANSWER QUICKLY
What are the five main phases of the cell cycle? What are the main events in each?
Answer:
In the adult organism, mitosis plays a role in cell replacement, wound healing and tumour formation. Mitosis, although a continuous process, is conventionally divided into five stages: prophase, prometaphase, metaphase, anaphase and telophase.
Cell cycle has different stages called G1, S, G2, and M. G1 is the stage where the cell is preparing to divide. To do this, it then moves into the S phase where the cell copies all the DNA.
Explanation:
good luck
please mark me as a brainliest
Plz I will give brainliest
explain how the genus and species name of an organism is properly written
Answer: The binomial system of nomenclature is structured so that the scientific name of a plant consists of two names: (1) the genus or generic name, and (2) the specific epithet or species name. ... The genus name is always underlined or italicized. The first letter of the genus name is always capitalized.
Explanation:
What makes an isotope radioactive? Are all isotopes radioactive?
Answer:
Radioactive Elements
In elements with more than 83 protons, all of the isotopes are radioactive. ... The force of repulsion among all those protons makes the nuclei unstable. Elements with more than 92 protons have such unstable nuclei that they don't even exist in nature.
Explanation:
hope it helps you
follow me for more
I'm willing to help
The products in our society that contribute the most waste are those that are _____.
Answer:
disposable
Explanation:
Biodegradable products do not really present any problems because they can decompose on their own, thus they do not create any pollution. Aluminum is not as dangerous to the environment as plastics, for example.
what are the differences between ligaments & tendons
3
ANNOTATE Write the inputs and outputs of cellular respiration on this diagram.
Answer:
Inputs---- glucose and oxygen.
Outputs----- ATP, carbondioxide and water.
Explanation:
The inputs of cellular respiration are the glucose and oxygen whereas the outputs of cellular respiration are energy in the form of ATP, carbondioxide gas and water. cellular respiration is a process in which glucose is broken down in the presence of oxygen gas for the production of energy in the form of ATP molecules. Carbondioxide gas and water which are the waste materials also produced in the end of cellular respiration process. Cellular respiration is the reverse of photosynthesis.
