Answer:
Please fix question or do you want both a and b with the mrna strand?
Explanation:
8. Which is an example of a medium of communication?
in an office setting
letting people know that Fridays will not have casual dress
a formal speech at a meeting
a person objecting to a point that has been made
GIVING BRAINLIEST AND THE REST OF MY POINTS!!!! :)
What life cycle adaptation does the desert gold poppy have that helps it reproduce and survive in its dry desert environment?
A) It produces large amounts of spores.
B) It only produces seeds in the summer when it is driest.
C) Its seeds stay dormant until there is enough precipitation for them to grow.
D) It can produce seeds all year round that can grow in dry and wet conditions.
Examine the Punnett square below. A cross between the two parents results in 50 offspring. How many of the offspring are most likely to have the dominant trait?
How does type 1 diabetes affect the cardiovascular system?
Answer:
diabetes can damage your blood vessels and the nerves that control your heart and blood vessels, causing to have a bad affect on your cardiovascular system.
Those individuals that are better able to survive in the Environment tend to be:
Answer:
Fit
Explanation:
They are the ones who are strong enough to survive.
List 4 chordate characteristics.
Answer:
notochord, dorsal hollow nerve cord, pharyngeal slits, and a post-an4l tail
Explanation:
had to censor second to last word but the 4 is an a
Someone PLEASE HELP!!!
Answer:
Autosomal Recessive
Explanation:
The method of inheritance is autosomal recessive. Notice how the disease skips the parent generation. This indicates that parents have the recessive allele but do not express the trait. The individuals who are shaded in have two recessive alleles that were passed on from their parents, therefore they have the disorder.
When two organisms from the same species compete for resources, it is______ competition.
Answer:
Intraspecific competition
Hope this helps!
Answer:
Competitive exclusion principal applies.
Explanation:
Basically, the chances of both species being equally successful is almost impossible. Chances are one will lose and will either leave empty-handed, injured, or won't live to leave at all.
Which of the following correctly describes how DNA contributes to the traits that appear in offspring? A) DNA contains the instructions for building RNA, which influences traits. B) DNA contains the instructions for building proteins, which create the physical traits of offspring. C) DNA contains the instructions for building carbohydrates, which are responsible for the physical traits of offspring. D) DNA contains the instructions for building enzymes, which catalyze chemical reactions for the traits of offspring.
DNA attributes to the genotype preference to the individual. DNA contains the instructions for building RNA, which influences traits. The correct statement is answer A.
What is the full form of DNA ?DNA stands for deoxyribonucleic acid.
DNA contains the orders that are needed for any organism in order to develop, survive as well as reproduce. To carry out these duties, DNA sequences are needed to be converted into messages which can be used to produce proteins in which are the complex molecules that are doing most of work in our body.
Since we have two pairs of chromosomes and we also have two pairs of genes in which one is from our father and one is from mother. These pairs of genes then determine certain physical features or traits.
Learn more about DNA at :
https://brainly.com/question/264225
#SPJ2
The picture shows a giraffe eating leaves.
Which describes the interaction?
abiotic interacting with abiotic
Obiotic interacting with biotic
abiotic interacting with biotic
Obiotic interacting with abiotic
Answer:
biotic interacting with biotic
Explanation:
both the giraff and leaves are living and both are biotic
Which term best describes the joints at the top of your
skull?
A.) Motionless
B.) Flexible
C.) Rubbery
D.) Elastic
Answer: A
Explanation:
the joints on the top of your skull is motionless
PLEASE HELP
The theory of plate tectonics is supported by evidence that crustal plates move relative to each other. How does this observation support the theory of plate tectonics?
It suggests that plates are dragged around by ocean currents.
It suggests that plates are dragged around by air currents.
It suggests that plates can move independently of one another.
It suggests that plates cannot move independently of one another.
Answer:
Its c the third answer
Explanation:
in dogs, being clumsy (C) is dominant to being cool (c) and being dazzling (D) is dominant to being docile (d)
Answer:
i didnt know that..!
Explanation:
Answer:
9/16
Explanation:
CcxCc = CC, Cc, Cc, cc (3/4)
DdxDd = DD, Dd, Dd, dd (3/4)
3/4 x 3/4 = 9/16
need help asap, will mark brainliest. PLSSS
How would an increase in the amount of solar energy available most likely affect a terrestrial community?
The amount of atmospheric carbon would decrease.
The amount of nitrogen in biomass would decrease.
The amount of sedimentary phosphorus would increase.
The amount of water in reservoirs would increase. (ik its not this one)
Tell me if you think caecilians are amphibians, reptiles, or fish.
Answer:
Amphibians
Explanation:
Why don't individuals with Tay-Sachs pass on the Tay-Sachs
allele?
a
Tay-Sachs disease is a recessive human genetic
disorder.
b Carriers are not affected.
c Affected individuals do not have children.
Answer:
Affected individuals do not have children.
Explanation:
Identify the structures of plants usually involved in vegetative reproduction
Answer:
b
Explanation:
dnakebtearyrea
What is true about one strand of DNA?
It contains many chromosomes.
It contains many proteins.
It contains many pieces of RNA.
It contains many genes.
Answer:
it contains many genes.
Answer:
D: It contains many genes
which problem do you think contributes most to water scarcity?
Answer:
Agriculture consumes more water than any other source and wastes much of that through inefficiencies. Climate change is altering patterns of weather and water around the world, causing shortages and droughts in some areas and floods in others. At the current consumption rate, this situation will only get worse.
-WWF
1. In the diagram, the arrow #9 is pointing to an organelle called
mitochondria
nucleus
smooth endoplasmic recticulum
endoplasmic recticulum
Answer:
Mitochondria
Explanation:
Sunlight allows producers and the animals that depend on them to live in the ______ zone.
A.abyssal
B.neuritic
C.bathyal
D.intertidal
Answer: B. Neuritic zone
what was explained by darwins theory of biological evolution
Answer:
When Organism A has a trait that negatively impacts it, or lacks a trait which would positively impact it, then said organism perishes, and its genes are not passed onto the next generation. On the flip side, when Organism B has a trait that positively impacts it, or lacks a trait that would negatively impact it, then the organism thrives, and its genes are passed onto the next generation.
Therefore, the next generation receives genes from Organism B and does not receive genes from Organism A. So, the next generation has traits that positively impact it and lacks traits that would negatively impact it, thus evolving according to Darwin.
Explanation:
What was explained by it? Evolution. But how did it explain evolution? That is in the answer.
What are some things you think would help identify a fossil? *
Answer: by studying the Fossil record we can tell how long life has existed on earth,and how different plants and animals are related to each other.often we can work out how and where they lived, and use this information to find out about ancient environments fossils can tell us about a lot about the past.
Explanation: If you like it please mark brainlest....
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Answer: Identify the promoter and the stop signal (terminator).
Explanation:
DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.
The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.
DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).
Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.
To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.
What are some physical properties of the sun?
Answer:
Mass: 1.98892 x 1030 kg.
Diameter: 1,391,000 kilometers.
Radius: 695,500 km.
Surface gravity of the Sun: 27.94 g.
Volume of the Sun: 1.412 x 1018 km3
Density of the Sun: 1.622 x 105 kg/m3
Explanation:
what is the term for the process of cell division that results in the formation of gametes ?
Answer:
meiosis
Explanation:
can you please answer these questions for me I really need help I am begging you
Answer:
1: 75%
2: 75%
3: 50%
4: 25%
In rabbits, spotted coat (S) is dominant to solid color (s) and black (B) is dominant to brown (b). A true-breeding black spotted rabbit is mated to a true-breeding brown solid rabbit to produce a heterozygous F1 generation. Two F1 individuals are mated, and you do not see a 9:3:3:1 (black spotted: black solid: brown spotted: brown solid) ratio of offspring, but instead see that almost all offspring are a non-recombinant phenotype. This tells you that
Answer:
Epistasis effect result into these offspring
Explanation:
Given
spotted coat (S) is dominant to solid color (s) and black (B) is dominant to brown (b)
Genotype of true-breeding black spotted rabbit BBSS
Genotype of true-breeding brown solid rabbit bbss
Genotype of offspring BbSs
In normal crossing between BbSs and BbSs offspring of F1, should produce offspring in the ratio 9:3:3:1
But it does not happens in this case the simple reason could be presence of Epistasis in which the alleles assort independently but do not express themselves because of the following reasons -
a) Interaction between two or more loci thereby resulting into new phenotypes
b) An allele at one locus masks effects of other allele at one or more loci
c) Allele at one locus modifies the effects of alleles at one or more other loci
I NEEEEEDDDD HELP PLEASE
Answer:
Proteins.
Explanation:
Genes contain instructions to assemble amino acids in proteins.
LOOK AT PIC!!!!!!!!!!!!!
Answer: black
Explanation:
Yes
Answer:
wow it is blank
Explanation:
