2x+9 = 35 solve for x

Answers

Answer 1

Answer:

x=13

Step-by-step explanation:

2x+9=35

2x=35-9

2x=26

x=26/2

x=13


Related Questions

What is the constant of proportionality?

Answers

The constant of proportionality is the ratio between two directly proportional quantities. Two quantities are directly proportional when they increase and decrease at the same ratetion:

please help me its hard!

Answers

Answer:

600

Step-by-step explanation:

Consider ABC and ACD as two triangles. And AC as a base to both of them

so,

AC = AO + OC

= 15 + 25

= 40

Now the area of ABC =

[tex]\frac{1}{2}\times AC\times OB\\= \frac{1}{2}\times 40 \times 10\\= 200[/tex]

In the same way, the area of ACD =

[tex]\frac{1}{2}\times AC\times OD\\= \frac{1}{2}\times 40 \times 20\\= 400[/tex]

Both added together 400 + 200 = 600

Pls help ASAP I’ll brainlest

Answers

Answer:

The answer is A.

Step-by-step explanation:

The school needs AT LEAST $5000 dollars. The only answers that say at least $5000 is A. and C. Then the school gave them 1000. So the answer would state that 60 students times the amount of money needed to be raised plus the additional money the school gave them is greater than 5000.

A. is saying that 60 students times X, which equals how much money each member has to raise. Plus 1000, which is how much the school gave them. Is greater than 5000 which is at least how much the need to raise.

WILL GIVE BRAINLST
HAVE AN AMAZING DAY :)

Answers

Answer:

x=3.5

Step-by-step explanation:

12x=4(x+2)+20

multiply the parentheses by 4

12x = 4x+8 +20

add 20 to 8

12x = 4x +28

subtract 4x on both sides

8x = 28

divide both sides by 8

x=3.5

Answer:

9.[tex] \:\:x = 3. 5[/tex]

10. y = 8x + 12

Step-by-step explanation:

9.

12x = 4(x + 2) + 20

12x = 4x + 8 + 20

12x - 4x = 28

8x = 28

x = 28/8

x = 7/2

[tex] x = 3.5 [/tex]

10.

Slope (m) = 8

Line is crossing y-axis at (0, 12)

y-intercept (b) = 12

Equation of line in slope-intercept form is given as:

y = mx + b

Plugging the values of m and b in the above equation, we find:

y = 8x + 12

Cos 20°. Cos10°+cos20°. Cos80°​

Answers

....................

-2g +5 factored

anyone know, please, i need this for school..

Answers

Answer:

-(2g-5)

Step-by-step explanation:

This is the only way i could think of factoring it, i hope this helps

Answer:

How to solve your problem

Step-by-step explanation:

Common factor

−2+5

−1(2−5)

Solution

−1(2−5)


1. If line m | line n and angle6 measures 55 degrees , what is the measure of angle1

Answers

Answer:

m<1 = 125°

Step-by-step explanation:

Given that line m is parallel to line n, therefore:

m<2 = m<6 (corresponding angles theorem)

m<2 = 55°

Therefore,

m<1 = 180° - m<2 (linear pair)

m<1 = 180° - 55°

m<1 = 125°

Can anyone help me on this please

Answers

x+y=2 hope this helps ❤️

A card game is being played and the 7 of clubs, 9 of hearts, 10 of spades, and
10 of hearts are drawn. In order to win the hand, the next card must be higher
than the highest card already on the table. Assuming the game is played with
a single deck, what is the chance that the next card drawn will win the hand?
(An ace has a value of 1.)
A. 12%
B. 24%
C. 3%
D. 25%

Answers

Answer:

Step-by-step explanation:

Only j,q,k beat 10 and there are four each of them so there are 12 cards that will beat the ten. 4 cards have already been drawn so there are 52-4=48 cards left in the deck, so the probability of beating the 10s is

12/48

1/4

Which is 25%

60°
Х
Х
X =
degrees.

Answers

Hope this helps I guess if not I’m sry

Answer:

60+x+x=180

=>60+2x=180

=>2x=120

=>x=120/2

=>x=60°

Step-by-step explanation:

please mark me as brainliest

7. A mailer for posters is a triangular prism as shown. Find the surface area of the mailer. (Example 3) 4.7 in. 18 in. 4.7 in. M.lohn Sininh 1234 Anysvert Anytown, 4 in. 5 in.​

Answers

Answer:

279.2 squared inches

Step-by-step explanation:

first find the base of the triangular prism which is  18*5=90.

then multiply 18*4.7 to get 84.6 then multiply that by 2 to get 169.2

then find the area of the triangles which is 4*5= 20 then add it all up which is equal to 279.2 ( 90 + 20) + 169.2= 279.2

Hope this was helpful :)

Find the simple interest on a loan of $45,000 for 5 years at 3%.

Answers

Answer:

51,750

Step-by-step explanation:

45,000x.03=1,350

1,350x5=6750

45,000+6750=51,750

Answer: $51,750

Is the answer

Can anyone help me on this please

Answers

Answer:

Step-by-step explanation:

which expression is equivalent to 20c-8d

Answers

Step-by-step explanation:

Your question is incomplete please edit it.

The answer is 4(5c-2d)

HELP ASAP!!!!!!!!!! in triangle ABC, m

Answers

Answer:

I think it is C

Step-by-step explanation:

Find the slope and reduce.
P=(-8, 3) Q=(-6, 2)

Answers

Answer: -1/2

Step-by-step explanation:

Slope is change in y over change in x. Y shifts down -1, while X shifts to the right 2

Lee el siguiente poema de Manuel Golmayo, las palabras tienen la longitud de las primeras 20 cifras de π:

Soy y seré a todos definible,

mi nombre tengo que daros,

cociente diametral siempre inmedible

soy de los redondos aros.

Inventa un poema que cumpla con esa misma condición, no tiene límite de largo... lo que tu ingenio te permita.

Answers

Answer:

but here is the answer 34+35 daylight

PLEASE HELP (5th grade math) giving away Brainliest

Answers

y=3x+1

(y=mx+b -> m=slope b=location on the y axis)
the slope is 3
b= 1

Answer:

y = [tex]\frac{3}{1}[/tex]+1

First, we should know what the slope-intercept formula is.

Y = MX + B

Where M is your slope, and B is your y intercept.

Let's do the easiest part first, finding our y-intercept. The y-intercept is where the the line intersects the y-axis. In this case, y = 1, because it intersects at (0, 1).

Now we have:

y = mx + 1

Next, we need to calculate the slope, or rise over run. M is presented as a fraction. The numerator is your rise (how high or low it goes), and the denomenator is your run (how far to the right or left it goes).

If it goes LEFT, the number is negative, if it goes RIGHT it is positive.

Also, pretty points are areas in which the line hits an exact coordinate. Using these points is easiest if you want to find the slope of the line.

We can see that the line hits a pretty point every time it goes one coordinate (box) to the right, and up three boxes. What this means it is rises three 3 points, and runs to the right, 1. This is shown as [tex]\frac{3}{1}[/tex]

So let's add that to the equation!

y = [tex]\frac{3}{1}[/tex]+1

60 kids get pick 29 play sports there are 887 kids how many play sport
a)1,835
b)2
c)713
d)428

Answers

Answer:

428

Step-by-step explanation:

Its says out of 60, 29 of them play sports

so we want to use proportions to solve for how many would play if there were 887 kids

[tex]\frac{60}{29} =2.068965517\\\frac{887}{2.068965517} = 428[/tex]

thus meaning that out of 887 kids 428 of them would play sports

What is the answer? Plz help me

Answers

Answer:

27y + 6r

Step-by-step explanation:

use the distributive property

3 * 9y = 27y

3 * 2r = 6r

27y + 6r

Plz mark as brainliest if this helped! Have a nice day!!!

-Lil_G

Help me plsssssss 2 1/2 x 3

Answers

exact form: 15/2
decimal form: 7.5
mixed number form: 7 1/2

A correlation coefficient is a(n): a. independent variable that is used in a correlational study. b. numerical indicator of the strength and direction of a relationship between two factors. c. index of the practical rather than the statistical significance of research findings. d. numerical indicator of the statistical significance of the findings in a particular research study.

Answers

Answer:

b. numerical indicator of the strength and direction of a relationship between two factors.

Step-by-step explanation:

Correlation coefficient:

The correlation coefficient between two variables is how closely they are related.

For example, in vectors with high correlation coefficient, they are similar, while with low coefficient, they are significantly different. So the correct answer is given by option b.

Can you help me please it has to be harry potter and the philosopher's stone movie

Answers

Answer and Step-by-step explanation:

Divide each side by 2.

x [tex]\geq[/tex] 5

This is the correct answer for getting the x by itself.

#teamtrees #PAW (Plant And Water)

Answer:

4

Step-by-step explanation:

2x10=20

I think...

PLSSSSSS HELLPPPPPPPPPPP
What is the total surface area of the square pyramid whose net is shown below?
400 in^3
1200 in^3
800 in^3
1600 in^3

Answers

Answer:

400+1200

1600inches^2

Name the shape of the hanging wire

Answers

Answer:

sorry Don didn't know ksjshsndjd

where? you didn’t attach it

¿CÓMO ALCANZÓ EL HOMBRE EL CONCEPTO DE INFINITO?

Answers

Trabajar con el infinito es un asunto complicado. Las paradojas de Zenón alertaron por primera vez a los filósofos occidentales sobre esto en 450 a. C. cuando argumentó que un corredor rápido como Aquiles tiene un número infinito de lugares para alcanzar durante la persecución de un corredor más lento. Desde entonces, ha habido una lucha por entender cómo usar la noción de infinito de una manera coherente. Este artículo se refiere al importante y controvertido papel que juegan los conceptos de infinito y el infinito en las disciplinas de la filosofía, las ciencias físicas y las matemáticas.

Los filósofos quieren saber si hay más de un concepto coherente de infinito; qué entidades y propiedades son infinitamente grandes, infinitamente pequeñas, infinitamente divisibles e infinitamente numerosas; y qué argumentos pueden justificar las respuestas de una forma u otra.

Aquí hay algunos ejemplos de estas cuatro formas diferentes de ser infinito. La densidad de la materia en el centro de un agujero negro es infinitamente grande. Un electrón es infinitamente pequeño. Una hora es infinitamente divisible. Los números enteros son infinitamente numerosos. Estas cuatro afirmaciones están ordenadas de mayor a menor controversia, aunque las cuatro han sido cuestionadas en la literatura filosófica.

Este artículo también explora una variedad de otras preguntas sobre el infinito. ¿Es el infinito algo indefinido e incompleto, o es completo y definido? ¿Qué quiso decir Tomás de Aquino cuando dijo que Dios es infinitamente poderoso? ¿Estaba en lo cierto Gauss, que fue uno de los más grandes matemáticos de todos los tiempos, cuando hizo la controvertida observación de que las teorías científicas involucran infinitos simplemente como idealizaciones y simplemente para facilitar la aplicación de esas teorías, cuando en realidad todas las entidades físicamente reales son ¿finito? ¿Cómo cambió la invención de la teoría de conjuntos el significado del término "infinito"? ¿Qué quiso decir Cantor cuando dijo que algunos infinitos son más pequeños que otros? Quine dijo que los primeros tres tamaños de los infinitos de Cantor son los únicos en los que tenemos motivos para creer. Los platónicos matemáticos no están de acuerdo con Quine. ¿Quién tiene razón? Veremos que existen profundas conexiones entre todas estas cuestiones.

jsheid kn ev ev jcb ebdbjd​

Answers

Answer:

he's not correct.

-15 = m

Step-by-step explanation:

-16 = -1 + m

-16 + 1 = m

-15 = m

Why does -1 became +1 , It is because you are adding 1 on both side so that we can cancel out the -1 and it will rest the m.

like this;

+1 -16 = -1 + m +1

-16 + 1 = (0 or nothing) + m

-15 = m

An article describes a study in which a new type of ointment was applied to forearms of volunteers to study the rates of absorption into the skin. Eight locations on the forearm were designated for ointment application. The new ointment was applied to six locations, and a control was applied to the other two. How many different choices were there for the six locations to apply the new ointment

Answers

Answer:

There were 28 different choices for the six locations to apply the new ointment

Step-by-step explanation:

The order in which the location are chosen is not important, which means that we use the combinations formula to solve this question.

Combinations formula:

[tex]C_{n,x}[/tex] is the number of different combinations of x objects from a set of n elements, given by the following formula.

[tex]C_{n,x} = \frac{n!}{x!(n-x)!}[/tex]

Two events, A and B are independent, if:

[tex]P(A \cap B) = P(A)P(B)[/tex]

How many different choices were there for the six locations to apply the new ointment?

Six locations from a set of 8. So

[tex]C_{8,6} = \frac{8!}{6!2!} = 28[/tex]

There were 28 different choices for the six locations to apply the new ointment

Find the area and perimeter of the polygons formed by the algebra tiles below: area: y X perimeter: 1 area: perimeter: 2​

Answers

Answer:

The answer is below

Step-by-step explanation:

a)

The area of the figure = sum of the area of the individual polygons

The area of the figure = x + 1 + y + 1 + x = 2x + y  + 2

The perimeter of the figure = sum of the length of the sides = 2(1 + (x + 1 + y + 1 + x)) = 2(2x + y + 3) = 4x + 2y + 6

b)

a)

The area of the figure = sum of the area of the individual polygons

The area of the figure = y² + xy + 1 + 1 + 1 = y² + xy + 3

The perimeter of the figure = sum of the length of the sides = (y + 1) + x + y + (y + 1) + y + 1 + 1 + 1 + x + 1 = 4y + 2x + 6

Please help I need the answer!!!

Answers

Answer:

A

Step-by-step explanation:

a

Other Questions
What characteristics do Percy and his mother have in common? How do they differ? Plz help me!Plz well mark brainliest if correct! distace x time graph will be ................ if the body is in ununiform motion Was there a contradiction between Balfours proposal to establish a national home for the Jewish people and the promise that nothing shall be done which may prejudice the civil and religious rights of existing non-Jewish communities in Palestine? If so, why did he make two contradictory promises? argumentative essay on genetically modified foodsCAN SOMEBODY HELP ME WITH DIS PLZZ DONT PUT ANYTHANG SLOW PLZZ help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks. If 2 cups makes 6 servings, how much makes 2 servings? shawtys been simping for so long..