10 How does no-till farming help the environment?
A It decreases soil erosion.
C It increases fertilizer use.
B It increases soil removal.
D It decreases crop yield.

Answers

Answer 1

Answer: Answer is A it will decrease soil erosion

Explanation:it just will trust me

Answer 2

Answer:

A.

Explanation:

the soil will not loosen when u till it


Related Questions

Help! Is there a way to email outlook support for help? If so please comment their email address, as I can't call them on their hotline right now.


Thank you, so much in advance! :)

Answers

Answer:

Explanation:

Even if you have a Hotmail email address, you now use the Outlook.com interface to ... I searched and found a Hotmail support number, but is it legit? ... one from Leo's e-mail, I receive a message from windows stating it can't find the site.

The answer is d but can anyone explain why and if not don't answer

Answers

Answer:

because the reaction can always be accelerated by heat

How do plants and animals rely on each other?​

Answers

Answer:

b

Explanation:

This diagrams represents...



a
a pure substance containing diatomic molecules
b
a pure substance containing compounds
c
a mixture containing compounds
d
a mixture of atoms

Answers

A.) a pure substance contains diatomic molecules

Rubidium Rb

when was the element discovered and by whom ??? ASAP MAKE IT AT LEAST A PARAGRAPH!!!

Answers

Answer:

Rubidium Rb was discovered in 1861It was discovered by the German chemist Robert Wilhelm Bunsen and the German physicist Gustav-Robert Kirchoff

Explanation:

Rubidium was discovered by the German chemists Robert Bunsen and Gustav Kirchhoff in 1861 while analyzing samples of the mineral lepidolite with a device called a spectroscope. The sample produced a set of deep red spectral lines they had never seen before. Bunsen was eventually able to isolate samples of rubidium metal. Today, most rubidium is obtained as a byproduct of refining lithium.

What is the freezing point, in °C, of a solution made with 1.31 mol of CHCl₃ in 530.0 g of CCl₄?

Answers

Answer:

-96.6°C

Explanation:

Given:

moles CHCl3 = 1.31 molmass CCl4 = 530.0 g

        mass CCl4 = 530.0 g * (1 kg / 1000)

        mass CCl4 = 0.5300 kg

First calculate the molality (m) of the solute, which is the moles of solute divided by the kg of solvent ([tex]\frac{moles}{kg}[/tex]):

molality CHCl3 = (mass moles CHCl3) / (mass CCl4 in kg)

molality CHCl3 = (1.31 mol) / (0.5300 kg)

molality CHCl3 = 2.471698m

Decrease in freezing point of solvent = (Kf) * (molality of solute)

Decrease in freezing point of CCl4 = (Kf) * (molality CHCl3)

Decrease in freezing point of CCl4 = (29.8°C/m) * (2.47m)

Decrease in freezing point of CCl4 = 73.6566°C

Then use the molality of the solute to calculate the change in freezing point and subtract the change from the original freezing point.

Freezing point of solution =

(freezing point of pure solvent) - (Decrease in freezing point)

Freezing point of solution = (-22.9°C) - (73.66°C)

Freezing point of solution = -96.6°C

Learn more about freezing point here: brainly.com/question/22888016

how do you determine the total mechanical energy stored of an object

Answers

An objects ability to do work is measured by its mechanical energy, or the sum the objects kinetic energy and potential energy. Mechanical energy is due to the position or movement of an object. The formula for mechanical energy is mechanical energy=kinetic energy + potential energy.

BRAINLIEST WILL BE GIVEN, PLZ HELP + 15 PTS

Which properties are characteristic of true solutions? (Select all that apply.)

The light beam is unaffected.
The particles are larger than 10 -8 cm.
The particles are dissolved.
The particles are suspended indefinitely.

Answers

A I just took the test

Answer:

The correct answer is the last option

Explanation:

Baby Mice

Seif's pet mouse had babies. Five of the babies were black and two were white. The
father mouse was black. The mother mouse was white. Seif and his friends wondered
why the mice were different colors. These were their ideas
Jerome: Baby mice inherit more traits from their fathers than their mothers
Alexa: The baby mice got half their traits from their father and half from their mother.
Juner Male traies are stronger than female traits.
Seif Rack mke have more traies than white mice.
Fiona: The black baby mice are probably make and the white baby mice are probably
female
India, Paver in die for colo don't matter what whine will
Consider Seif and his friends responses/ideas. Answer the
following questions:

1. Which friend has the correct answer about how traits are inherited in this method of reproduction?

2. Is this type of reproduction asexual or sexual? How do you know? (use details from the texti

Answers

Answer:

I would say for #1 Fiona and for #2 sexual

Explanation:

Please give brailiest

What causes thermal pollution in rivers?
1. automobile exhaust
2. nuclear power plants
3. solar radiation
4. factory smokestacks

Answers

Answer:

nuclear power plants .....

NO LINKS07.02 LC)
What happens when a particle and its antiparticle collide? (2 points)
O They combine nuclei
O They break into quarks
They are converted to energy
O They become antimatter

Answers

I believe they are converted to energy

When a particle and its antiparticle collide they are converted to energy.

What is collide?

A colloid would be a mixture in which a component made up of insoluble particles that are scattered at a microscopic scale is suspended within another component.

What is energy?

In order to accomplish work and to produce heat as well as light, energy must be supplied to a body or even to a physical system. Energy would be the quantitative attribute that does this. Energy would be transformed in form but cannot be created and destroyed, according to the rule of conservation of energy.

Annihilation occurs when a particle collides including its anti-particle. The particle and its antiparticle's whole mass are transformed back into energy to produce two gamma-ray photons. You won't find antiparticles in everyday stuff since they typically barely last for a tiny amount of time until annihilation takes place.

Therefore, the correct answer will be option (c).

To know more about energy and collide

https://brainly.com/question/11647605

#SPJ2

If 0.583 g of ammonia (NH3) is dissolved to make 250 mL of solution, what is the molarity?

Answers

Answer:

0.137 M NH3

Explanation:

First divide the mass of NH3 by the molar mass of NH3, and then divide by the volume to get molarity.

0.583 g / 17.031 g/mol = 0.0342 mol NH3

0.0342 mol NH3 / 0.250 L = 0.137 M NH3

Use the balanced equation from #13 to answer the following:

Calculate how many moles of SO2 can be produced with when given 75 grams of CS2.


Now calculate how many moles of SO2 can be produced with when given 96 grams of O2.




Which one is the limiting reactant (75 grams of CS2 or 96 grams of O2)? How do you know?

Answers

Answer:

1. 9600 moles

2. 4096 moles

Explanation:

CS2 + 3 O2=> CO2 + 2 SO2

1. The ratio for CS2: SO2 is :

1:2

If there are 75g of CS2 then there are:

75 × 2= 150g of SO2

Moles = mass × Mr

Moles = 150 × 64

Moles = 9600

2. The ratio for O2 : SO2 is:

3:2

If there are 96g of O2 then there are:

96 × 2/3 = 64g of SO2

moles = mass × Mr

Moles = 64 × 64

Moles = 4096

Answer:  The FitnessGram PACER Test is a multistage aerobic capacity test that progressively gets more difficult as it continues. The test is used to measure a student's aerobic capacity as part of the FitnessGram assessment. Students run back and forth as many times as they can, each lap signaled by a beep sound.

Explanation:

Stronger acids are those that -
O more completely inhibit polarity in water
O exhibit hydrogen bonding
O hold on to their protons more strongly
O lose their protons more easily

Answers

Answer: lose their protons more easily

A 1.83 mol sample of carbon reacts with excess zinc oxide to produce zinc and carbon dioxide. How many moles of zinc oxide are consumed?

Answers

Answer:

3.66 moles of Zinc Oxide are consumed

Explanation:

Based on the reaction:

C + 2ZnO → 2Zn + CO₂

Where 1 mole of Carbon reacts with 2 moles of Zin Oxide to produce 2 moles of Zinc and 1 mole of Carbon Dioxide.

To solve this question, we must convert the moles of carbon added to the moles of Zinc Oxide that react using the chemical equation (1mol C = 2mol ZnO):

1.83 moles C * (2mol ZnO / 1mol C) =

3.66 moles of Zinc Oxide are consumed

WHAT INVESTMENT OF A $125 WOULD HAVE THE MOST LASTING VALUE FOR YOUR FUTURE?
A pair of jordans
Some nice cologne or perfume
3 college credits at MCC BAG
a dinner with 2 or 3 people​

Answers

Answer:

a pair of jordans

Explanation:

What’s the easiest way to add energy to matter

Answers

Answer:

The easiest way is to heat matter which raises its internal energy andso the mass as well. Another possibility is to accelerate matter as in case of protons or heavy ions in the LHC, Protons ,for example , are accelerated to the energies of 6500 GeV which means increase of the rest mass by a factor of almost 7000

Select whether the statement is for Speed, Velocity, or Acceleration.

The car speeds up from 5 mph to 10 mph.

Speed
Acceleration
Velocity

Answers

Answer:

Explanation:

acceleration no cap

According to kinetic molecular theory, collisions between gas particles in a sample of an ideal gas 1. increase the energy content of the gas sample 2. produce strong attractive forces between the gas particles 3. result in a net loss of energy by the gas sample 4. transfer energy between the gas particles​

Answers

Answer:

should you prove this or explain or pick the correct answer

According to the kinetic molecular theory, collisions between gas particles in a sample of an ideal gas: Transfer energy between the gas particles. Hence, option 4 is correct.

What is kinetic theory of gases ?

According to kinetic theory of gases, when gas particles collide with each other, they transfer energy between themselves. Some collisions will result in the transfer of kinetic energy from one particle to another, while others may result in a transfer of potential energy due to the intermolecular forces between the particles.

However, the total energy of the gas particles is conserved during these collisions, so there is no net loss or gain of energy by the gas sample as a whole.

The kinetic molecular theory also states that ideal gas particles do not have any significant attractive or repulsive forces between them, so option 2 is incorrect.

Additionally, collisions between gas particles do not increase the energy content of the gas sample (option 1) or result in a net loss of energy by the gas sample (option 3).

Find more on kinetic theory:

https://brainly.com/question/14349214

#SPJ2

Which unit is commonly used for measuring pressure?
O m3
O bar
O N/m3
O Celsius​

Answers

Answer:

3

Explanation:

Answer:

bar

Explanation:

yes

if an EXOTHERMIC reaction takes place in a container, the container will feel
a. hotter
b.colder
c. neither hotter nor colder

Answers

The answer to your question is A

What is happening when an oxygen molecule is formed from two separate oxygen atoms?

Answers

They share four electrons, two from each oxygen atom

______ is the tendency of an organism to maintain a constant and stable internal environment

Answers

Answer:

Homeostasis is the answer

Explanation: it maintains a constant and stable environment

Nuclear power:

accounts for half of the energy used in the U.S.
creates less energy than fossil fuels
is a nonrenewable resource
is a renewable resource

Answers

Answer:

Is a nonrenewable resource

Explanation:

"The fuel for fusion reactors can be drawn from sea water in an almost unlimited supply. The fuel for fission, on the other hand, comes from a limited supply of uranium. Once it is depleted, it cannot be easily replenished. For this reason, nuclear power is considered a nonrenewable resource."

I got this source from ODY

Hope I could help! :)

Have a nice day

Answer:

is a nonrenewable resource

Explanation:

Why do you think the same color M&M was used in each sample of water?

Answers

Answer:

The candy coating is made up of coloring and sugar. The coloring and the sugar molecules both have positive and negative charges on them. The water molecule has positive and negative charges so it can attract and dissolve the color and sugar pretty well.

Explanation:

go to https://www.acs.org/content/acs/en/education/whatischemistry/adventures-in-chemistry/experiments/dissolving-m-ms.html#:~:text=The%20candy%20coating%20is%20made,color%20and%20sugar%20pretty%20well.

Select whether the statement is for Speed, Velocity, or Acceleration.

The earth travels at 30 kilometers per second.

Velocity
Speed
Acceleration

Answers

Answer:

I think that the statement is relative to speed because it is saying km per second.

Answer:

Speed

Explanation:

zinc, sulphur, oxygen
What would this compound be called?

Answers

Zinc sulphate

Zinc sulphateZnSO₄

This is the answer.

How will popcorn protect a egg by reducing the force of impact on the egg? How does it work?

Answers

Answer:

The popcorn will take less impact because the force goes into the popcorn serving as a cushion for the egg. The egg will take less damage because the force will cancel out.

Explanation:

what type of cells are these?
(Plant or animal)

Answers

Answer:

5 is an animal cell, 6 is a plant cell

Explanation:

hope this helps!

5.Animal because it looks like the cells on an octopus tentacle


6.Plant because that looks like the cells on a crease of a leaf



Hope this helps

Captain uses a steering wheel called him to turn the rudder A sailing ship do you think it would be easier for him to turn a large wheel or a small wheel explain why you think so

Answers

Answer:

Large wheel.

Explanation:

It would be easier for the captain to turn a large wheel as compared to a small wheel because less amount of effort is needed by the captain to turn the rudder. If a steering wheel is small, more effort and force is required to turn it while on the other hand, if the steering wheel is large, small effort is needed to turn the rudder. The large size of a sailing boat's steering wheel can help the captain to have more control over the boat as compared to small steering wheel and he is able to access it from either side of the boat.

Other Questions
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others. Which detail from paragraphs 22-25 best supports the concept of the "democratization" of social media in paragraph 22?A "mainstream media and institutions tend to invisibilizewomen, Howard says, the truth is getting more and moredifficult to ignore as these women so visibly lead the charge (Paragraph 22)B "they're working on a Juneteenth celebration with food trucks, speakers and performers - something to bring people together as the nation commemorates the end of slavery" ( Paragraph 23)C "Thomas anticipates she'll be busy organizing more events throughout the summer" (Paragraph 24)D "We're going to be dedicating our time to this to make sure things actually happen, Thomas says." ( Paragraph 25) Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down How does learning a different language helps you with communication skills find the area of the triangle answer in digital format only Malcolm is filling bags with rice. He starts with a 5 1 over 4 pound container of rice and fills eachbag with pound of rice. How many bags of rice can Malcolm fill? Name that meme -For 50 Points The school nurse took care of five students on Monday and four of the five students had a cough. The school nurse determined that 80% of the students in her school were coming down with colds. Which of the following would best describe why her conclusion was invalid? Calculate the speed of an object that travels 75m in 15s. Write and Solve Equations-Word ProblemsFor each context, draw a model, write an equation, and then write a complete sentence to answer the question in the context. If you were asked to round the number 9.6173 to the nearest hundredths place, how many digits would you have after the decimal point? the process of preparing and setting up a software on a computer is called what was explained by darwins theory of biological evolution John wanted to buy his favorite rubber shoes. Its original price is $105. He is lucky today because the shoes that he wanted to buy is 30% off the original price. How much will John pay now for his shoes? Find the value of x. Then find the mB and mC. Why/how did the Black Identity or Black Arts Movement influence visual art? Suppose the Federal Reserve sets the reserve requirement at 14%, banks hold no excess reserves, and no additional currency is held. Instructions: In part a, round your answer to 1 decimal place. In parts b and c, enter your answers as a whole number. If you are entering a negative number include a minus sign. a. What is the money multiplier People who choose not be part of either party are known as ______________.a.independentsb.conservativesc.moderatesd.liberals